Construct: ORF TRCN0000472391
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005904.1_s317c1
- Derived from:
- ccsbBroadEn_02712
- DNA Barcode:
- ACAGAACGCGAGCCCATGGGGAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FAIM2 (23017)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472391
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23017 | FAIM2 | Fas apoptotic inhibitory mo... | NM_012306.4 | 100% | 100% | |
2 | human | 23017 | FAIM2 | Fas apoptotic inhibitory mo... | XM_005268730.3 | 83.7% | 79% | (many diffs) |
3 | mouse | 72393 | Faim2 | Fas apoptotic inhibitory mo... | NM_028224.4 | 88.2% | 91.7% | (many diffs) |
4 | mouse | 72393 | Faim2 | Fas apoptotic inhibitory mo... | XM_006521449.3 | 88.2% | 91.7% | (many diffs) |
5 | mouse | 72393 | Faim2 | Fas apoptotic inhibitory mo... | NM_001038658.2 | 85.3% | 89.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1014
- ORF length:
- 948
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ccagggaaag ctctccgtgg ctaacaaggc ccctgggacc gaggggcagc 121 agcaggtgca tggcgagaag aaggaggctc cagcagtgcc ctcagcccca ccctcctatg 181 aggaagccac ctctggggag gggatgaagg caggggcctt ccccccagcc cccacagcgg 241 tgcctctcca ccctagctgg gcctatgtgg accccagcag cagctccagc tatgacaacg 301 gtttccccac cggagaccat gagctcttca ccactttcag ctgggatgac cagaaagttc 361 gtcgagtctt tgtcagaaag gtctacacca tcctgctgat tcagctgctg gtgaccttgg 421 ctgtcgtggc tctctttact ttctgtgacc ctgtcaagga ctatgtccag gccaacccag 481 gctggtactg ggcatcctat gctgtgttct ttgcaaccta cctgaccctg gcttgctgtt 541 ctggacccag gaggCATTTC CCCTGGAACC TGATTCTCCT GACCGTCTTT ACCCTGTCCA 601 TGGCCTACCT CACTGGGATG CTGTCCAGCT ACTACAACAC CACCTCCGTG CTGCTGTGCC 661 TGGGCATCAC GGCCCTTGTC TGCCTCTCAG TCACCGTCTT CAGCTTCCAG ACCAAGTTCG 721 ACTTCACCTC CTGCCAGGGC GTGCTCTTCG TGCTTCTCAT GACTCTTTTC TTCAGCGGAC 781 TCATCCTGGC CATCCTCCTA CCCTTCCAAT ATGTGCCCTG GCTCCATGCA GTTTATGCAG 841 CACTGGGAGC GGGTGTATTT ACATTGTTCC TGGCACTTGA CACCCAGTTG CTGATGGGTA 901 ACCGACGCCA CTCGCTGAGC CCTGAGGAGT ATATTTTTGG AGCCCTCAAC ATTTACCTAG 961 ACATCATCTA TATCTTCACC TTCTTCCTGC AGCTTTTTGG CACTAACCGA GAATGCCCAA 1021 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1081 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1141 TATCTTGTGG AAAGGACGAA CAGAACGCGA GCCCATGGGG AAAACGCGTT AAGTCgacaa 1201 tcaacctctg gattacaaaa tttgtgaaag att