Transcript: Mouse XM_006521449.3

PREDICTED: Mus musculus Fas apoptotic inhibitory molecule 2 (Faim2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Faim2 (72393)
Length:
4553
CDS:
462..1415

Additional Resources:

NCBI RefSeq record:
XM_006521449.3
NBCI Gene record:
Faim2 (72393)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215394 CAACATCTACTTAGACATTAT pLKO.1 1346 CDS 100% 13.200 9.240 N Faim2 n/a
2 TRCN0000217485 GATTCTGCTGACCATCTTTAC pLKO.1 971 CDS 100% 10.800 7.560 N Faim2 n/a
3 TRCN0000179562 GAAAGGTCTATACCATCCTAT pLKO.1 775 CDS 100% 4.950 3.465 N Faim2 n/a
4 TRCN0000181038 CCAGTTACTACAACACCACAT pLKO.1 1024 CDS 100% 4.050 2.835 N Faim2 n/a
5 TRCN0000181101 CATCTTCAGTTTCCAGACCAA pLKO.1 1094 CDS 100% 2.640 1.848 N Faim2 n/a
6 TRCN0000184221 GCATCTTCCAAATGGCACAGT pLKO.1 1652 3UTR 100% 2.640 1.848 N Faim2 n/a
7 TRCN0000180921 GCTTGTACATATGCCATGCTT pLKO.1 1575 3UTR 100% 0.000 0.000 N Faim2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02712 pDONR223 100% 88.2% 91.7% None (many diffs) n/a
2 ccsbBroad304_02712 pLX_304 0% 88.2% 91.7% V5 (many diffs) n/a
3 TRCN0000472391 ACAGAACGCGAGCCCATGGGGAAA pLX_317 48.5% 88.2% 91.7% V5 (many diffs) n/a
Download CSV