Construct: ORF TRCN0000472624
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005717.1_s317c1
- Derived from:
- ccsbBroadEn_14963
- DNA Barcode:
- ACCGCCCGTTCCTTCACTTTTTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TOMM40 (10452)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472624
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10452 | TOMM40 | translocase of outer mitoch... | NM_001128916.1 | 99.9% | 99.7% | 8A>G |
| 2 | human | 10452 | TOMM40 | translocase of outer mitoch... | NM_001128917.2 | 99.9% | 99.7% | 8A>G |
| 3 | human | 10452 | TOMM40 | translocase of outer mitoch... | NM_006114.3 | 99.9% | 99.7% | 8A>G |
| 4 | human | 10452 | TOMM40 | translocase of outer mitoch... | XM_005258411.4 | 90.5% | 86.4% | (many diffs) |
| 5 | mouse | 53333 | Tomm40 | translocase of outer mitoch... | NM_001109748.1 | 88.4% | 92.7% | (many diffs) |
| 6 | mouse | 53333 | Tomm40 | translocase of outer mitoch... | NM_016871.2 | 88.4% | 92.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1149
- ORF length:
- 1083
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gagcgtgttg gctgccagct cgccgcccgc agggccgcca ccgccgcctg 121 cgccggccct cgtggggctg ccgccacctc cgccctcgcc gccgggcttc acgctgccgc 181 cgctgggagg cagcctgggc gccggcacca gtacgagtcg aagttcggaa cggacccccg 241 gggctgcaac cgccagcgcc tcaggggccg ccgaggatgg ggcctgcggc tgcctgccca 301 acccgggcac attcgaggag tgccaccgga agtgcaagga gctgtttccc attcagatgg 361 agggtgtcaa gctcacagtc aacaaagggt tgagtaacca ttttcaggtc aaccacacag 421 tagccctcag cacaatcggg gagtccaact accacttcgg ggtcacatat gtggggacaa 481 agcagctgag tcccacagag gcgttccctg tactggtggg tgacatggac aacagtggca 541 gtctcaacgc tcaggtcatt caccagctgg gccccggtct caggtccaag atggccatcc 601 agacccagca gtcgaagttt gtgaactggc aggtggacgg ggagtatcgg ggctctgact 661 tcacagcagc cgtcaccctg gggaacccag acgtccTCGT GGGTTCAGGA ATCCTCGTAG 721 CCCACTACCT CCAGAGCATC ACGCCTTGCC TGGCCCTGGG TGGAGAGCTG GTCTACCACC 781 GGCGGCCTGG AGAGGAGGGC ACTGTCATGT CTCTAGCTGG GAAATACACA TTGAACAACT 841 GGTTGGCAAC GGTAACGTTG GGCCAGGCGG GCATGCACGC AACATACTAC CACAAAGCCA 901 GTGACCAGCT GCAGGTGGGT GTGGAGTTTG AGGCCAGCAC AAGGATGCAG GACACCAGCG 961 TCTCCTTCGG GTACCAGCTG GACCTGCCCA AGGCCAACCT CCTCTTCAAA GGCTCTGTGG 1021 ATAGCAACTG GATCGTGGGT GCCACGCTGG AGAAGAAGCT CCCACCCCTG CCCCTGACAC 1081 TGGCCCTTGG GGCCTTCCTG AATCACCGCA AGAACAAGTT TCAGTGTGGC TTTGGCCTCA 1141 CCATCGGCTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1201 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1261 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAACCGCC CGTTCCTTCA CTTTTTACAC 1321 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt