Transcript: Human NM_006114.3

Homo sapiens translocase of outer mitochondrial membrane 40 (TOMM40), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TOMM40 (10452)
Length:
1673
CDS:
68..1153

Additional Resources:

NCBI RefSeq record:
NM_006114.3
NBCI Gene record:
TOMM40 (10452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006114.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231154 ATCACCGCAAGAACAAGTTTC pLKO_005 1104 CDS 100% 10.800 15.120 N TOMM40 n/a
2 TRCN0000231155 TGAATGGCGCTTCGGGATTCT pLKO_005 1328 3UTR 100% 4.950 6.930 N TOMM40 n/a
3 TRCN0000072433 GCACGCAACATACTACCACAA pLKO.1 877 CDS 100% 4.050 5.670 N TOMM40 n/a
4 TRCN0000231153 ACGCAACATACTACCACAAAG pLKO_005 879 CDS 100% 10.800 8.640 N TOMM40 n/a
5 TRCN0000216664 CATGTCTCTAGCTGGGAAATA pLKO.1 808 CDS 100% 13.200 9.240 N Tomm40 n/a
6 TRCN0000231152 CATGTCTCTAGCTGGGAAATA pLKO_005 808 CDS 100% 13.200 9.240 N TOMM40 n/a
7 TRCN0000219098 CAAAGGGTTGAGTAACCATTT pLKO_005 385 CDS 100% 10.800 7.560 N TOMM40 n/a
8 TRCN0000072435 CCAGCAGTCGAAGTTTGTGAA pLKO.1 607 CDS 100% 4.950 3.465 N TOMM40 n/a
9 TRCN0000072436 CTTCCTGAATCACCGCAAGAA pLKO.1 1096 CDS 100% 4.950 3.465 N TOMM40 n/a
10 TRCN0000072437 CGCAAGAACAAGTTTCAGTGT pLKO.1 1109 CDS 100% 2.640 1.848 N TOMM40 n/a
11 TRCN0000072434 GCTCACAGTCAACAAAGGGTT pLKO.1 373 CDS 100% 2.640 1.848 N TOMM40 n/a
12 TRCN0000279300 GGGAGTCCAACTACCACTTTG pLKO_005 441 CDS 100% 10.800 7.560 N Tomm40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006114.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14963 pDONR223 94.8% 99.9% 99.7% None 8A>G n/a
2 ccsbBroad304_14963 pLX_304 0% 99.9% 99.7% V5 8A>G n/a
3 TRCN0000472624 ACCGCCCGTTCCTTCACTTTTTAC pLX_317 41.9% 99.9% 99.7% V5 8A>G n/a
Download CSV