Construct: ORF TRCN0000472637
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006958.1_s317c1
- Derived from:
- ccsbBroadEn_02588
- DNA Barcode:
- ATGTTGGTTGGCTCCGACAGTAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CCNI (10983)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472637
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10983 | CCNI | cyclin I | NM_001348132.1 | 100% | 100% | |
2 | human | 10983 | CCNI | cyclin I | NM_001348133.1 | 100% | 100% | |
3 | human | 10983 | CCNI | cyclin I | NM_006835.3 | 100% | 100% | |
4 | human | 10983 | CCNI | cyclin I | NM_001348134.1 | 92.7% | 86% | (many diffs) |
5 | human | 10983 | CCNI | cyclin I | NM_001348135.1 | 89.1% | 89.1% | 336_337ins123 |
6 | human | 10983 | CCNI | cyclin I | NM_001348136.1 | 88.5% | 88.5% | 112_113ins129 |
7 | human | 10983 | CCNI | cyclin I | NM_001348137.1 | 80.9% | 80.9% | 243_244ins216 |
8 | human | 10983 | CCNI | cyclin I | NM_001348138.1 | 72.1% | 71.8% | 0_1ins313;2_3insGA |
9 | human | 10983 | CCNI | cyclin I | NM_001348139.1 | 69.4% | 69.4% | 114_115ins345 |
10 | human | 10983 | CCNI | cyclin I | NM_001348140.1 | 55.4% | 41.5% | 459_460ins79;627_628ins425 |
11 | mouse | 12453 | Ccni | cyclin I | NM_017367.3 | 92.8% | 93.8% | (many diffs) |
12 | mouse | 12453 | Ccni | cyclin I | XM_006534736.3 | 92.8% | 93.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gtttccaggg cctttggaaa accagagatt gtctttcctg ttggaaaagg 121 caatcactag ggaagcacag atgtggaaag tgaatgtgcg gaaaatgcct tcaaatcaga 181 atgtttctcc atcccagaga gatgaagtaa ttcaatggct ggccaaactc aagtaccaat 241 tcaaccttta cccagaaaca tttgctctgg ctagcagtct tttggatagg tttttagcta 301 ccgtaaaggc tcatccaaaa tacttgagtt gtattgcaat cagctgtttt ttcctagctg 361 ccaagactgt tgaggaagat gagagaattc cagtactaaa ggtattggca agagacagtt 421 tctgtggatg ttcctcatct gaaattttga gaatggagag aattattctg gataagttga 481 attgggatct tcacacagcc acaccattgg attttcttca tattttccat gccattgcag 541 tgtcaactag gcctcagtta cttttcagtt tgcccaaatt gagcccatct caacatttgg 601 cagtccttac caagcaacta cttcactgta tggcctgcaa ccaacttctg caattcagag 661 gatccatgct tgctctggcc atggttagtc tggaaatgga gaaactcatt cctgattggc 721 tttctcttac aattgaactg cttcagaaag cacagatgga tagctcccag ttgatccatt 781 gtcgggagct tgtggcacat cacctttcTA CTCTGCAGTC TTCCCTGCCT CTGAATTCCG 841 TTTATGTCTA CCGTCCCCTC AAGCACACCC TGGTGACCTG TGACAAAGGA GTGTTCAGAT 901 TACATCCCTC CTCTGTCCCA GGCCCAGACT TCTCCAAGGA CAACAGCAAG CCAGAAGTGC 961 CAGTCAGAGG TACAGCAGCC TTTTACCATC ATCTCCCAGC TGCCAGTGGG TGCAAGCAGA 1021 CCTCTACTAA ACGCAAAGTA GAGGAAATGG AAGTGGATGA CTTCTATGAT GGAATCAAAC 1081 GGCTCTATAA TGAAGATAAT GTCTCAGAAA ATGTGGGTTC TGTGTGTGGC ACTGATTTAT 1141 CAAGACAAGA GGGACATGCT TCCCCTTGTC CACCTTTGCA GCCTGTTTCT GTCATGTACC 1201 CGACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1261 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1321 ATATATCTTG TGGAAAGGAC GAATGTTGGT TGGCTCCGAC AGTAACACGC GTTAAGTCga 1381 caatcaacct ctggattaca aaatttgtga aagatt