Transcript: Human NM_001348138.1

Homo sapiens cyclin I (CCNI), transcript variant 8, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
CCNI (10983)
Length:
1883
CDS:
858..1676

Additional Resources:

NCBI RefSeq record:
NM_001348138.1
NBCI Gene record:
CCNI (10983)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045205 GATAAGTTGAATTGGGATCTT pLKO.1 948 CDS 100% 4.950 3.960 N CCNI n/a
2 TRCN0000288846 GATAAGTTGAATTGGGATCTT pLKO_005 948 CDS 100% 4.950 3.960 N CCNI n/a
3 TRCN0000045203 CGGCTCTATAATGAAGATAAT pLKO.1 1557 CDS 100% 13.200 9.240 N CCNI n/a
4 TRCN0000288847 CGGCTCTATAATGAAGATAAT pLKO_005 1557 CDS 100% 13.200 9.240 N CCNI n/a
5 TRCN0000045204 GCAGTCCTTACCAAGCAACTA pLKO.1 1077 CDS 100% 4.950 3.465 N CCNI n/a
6 TRCN0000288784 GCAGTCCTTACCAAGCAACTA pLKO_005 1077 CDS 100% 4.950 3.465 N CCNI n/a
7 TRCN0000045206 GCCAAGACTGTTGAGGAAGAT pLKO.1 839 5UTR 100% 4.950 3.465 N CCNI n/a
8 TRCN0000288848 GCCAAGACTGTTGAGGAAGAT pLKO_005 839 5UTR 100% 4.950 3.465 N CCNI n/a
9 TRCN0000045207 CGCAAAGTAGAGGAAATGGAA pLKO.1 1509 CDS 100% 3.000 2.100 N CCNI n/a
10 TRCN0000077800 CCAGAAACATTTGCTCTGGCA pLKO.1 731 5UTR 100% 0.066 0.053 N Ccni n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02588 pDONR223 100% 72.1% 71.8% None 0_1ins313;2_3insGA n/a
2 ccsbBroad304_02588 pLX_304 0% 72.1% 71.8% V5 0_1ins313;2_3insGA n/a
3 TRCN0000472637 ATGTTGGTTGGCTCCGACAGTAAC pLX_317 34.6% 72.1% 71.8% V5 0_1ins313;2_3insGA n/a
Download CSV