Construct: ORF TRCN0000472686
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006462.1_s317c1
- Derived from:
- ccsbBroadEn_13952
- DNA Barcode:
- TGAAAGCCTCTTTCTGAAAGGGTC
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SHMT2 (6472)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472686
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NM_001166356.2 | 99.9% | 99.1% | 1470delT |
| 2 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NM_005412.6 | 97.9% | 97.2% | 595_624del;1500delT |
| 3 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NM_001166357.1 | 93.7% | 93% | 0_1ins63;532_561del;1437delT |
| 4 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NM_001166358.2 | 93.7% | 93% | 0_1ins63;532_561del;1437delT |
| 5 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NM_001166359.1 | 93.7% | 93% | 0_1ins63;532_561del;1437delT |
| 6 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | XM_011538675.3 | 75.6% | 60.5% | 0_1ins316;279_336del;1212delT |
| 7 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | XM_011538676.3 | 75.6% | 60.5% | 0_1ins316;279_336del;1212delT |
| 8 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | XM_011538677.3 | 75.6% | 60.5% | 0_1ins316;279_336del;1212delT |
| 9 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | XM_011538678.2 | 75.6% | 60.5% | 0_1ins316;279_336del;1212delT |
| 10 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NR_029417.2 | 64.9% | (many diffs) | |
| 11 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NR_029416.2 | 64.5% | (many diffs) | |
| 12 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NR_029415.1 | 63.8% | (many diffs) | |
| 13 | human | 6472 | SHMT2 | serine hydroxymethyltransfe... | NR_048562.1 | 56.7% | (many diffs) | |
| 14 | mouse | 108037 | Shmt2 | serine hydroxymethyltransfe... | NM_028230.4 | 86.2% | 91.6% | (many diffs) |
| 15 | mouse | 108037 | Shmt2 | serine hydroxymethyltransfe... | NM_001252316.1 | 85.6% | 91% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1548
- ORF length:
- 1482
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaataag 61 ttggcatgct gtacttctct ttgttttggg cggctcggcc tctgcagaga tgtgggcagc 121 tggtcaggat ggccattcgg gctcagcaca gcaacgcagc ccagactcag actggggaag 181 caaacagggg ctggacaggc caggagagcc tgtcggacag tgatcctgag atgtgggagt 241 tgctgcagag ggagaaggac aggcagtgtc gtggcctgga gctcattgcc tcagagaact 301 tctgcagccg agctgcgctg gaggccctgg ggtcctgtct gaacaacaag tactcggagg 361 gttatcctgg caagagatac tatgggggag cagaggtggt ggatgaaatt gagctgctgt 421 gccagcgccg ggccttggaa gcctttgacc tggatcctgc acagtgggga gtcaatgtcc 481 agccctactc cgggtcccca gccaacctgg ccgtctacac agcccttctg caacctcacg 541 accggatcat ggggctggac ctgcccgatg ggggccatct cacccacggc tacatgtctg 601 acgtcaagcg gatatcagcc acgtccatct tcttcgagtc tatgccctat aagctcaacc 661 tggcactgac tgctcgactt ttccggccac ggctcatcat agctggcacc agcgcctatg 721 ctcgcctcat tgactacgcc cgcatgagag aggtgtgtga tgaagtcaaa gcacacctgc 781 tggcagacat ggcccacatc agtggcctgg tggctgccaa ggtgattccc tcgcctttca 841 agcacgcgga catcgtcacc accactactc acaagactct tcgaggggcc aggtcagggc 901 tcatcttcta ccggaaaggg gtgaaggctg tggaccccaa gactggccgg gagatccctt 961 acacatttga ggaccgaatc aactttgccg tgttcccatc cctgcagggg ggcccccaca 1021 atcatgccat tgctgcagta gctgtggccc taaagcaggc ctgcaccccc atgttccggg 1081 agtactccct gcaggttctg aagaatgctc gggccatggc agatgccctg ctagagcgag 1141 gctactcact ggtatcaggt ggtactgaca accacctggt gctggtggac ctgcggccca 1201 agggcctgga tggagctcgg gctgagcggg tgctagagct tgtatccatc actgccaaca 1261 agaacacctg tcctggagac cgaagtgcca tcacaccggg cggccTGCGG CTTGGGGCCC 1321 CAGCCTTAAC TTCTCGACAG TTCCGTGAGG ATGACTTCCG GAGAGTTGTG GACTTTATAG 1381 ATGAAGGGGT CAACATTGGC TTAGAGGTGA AGAGCAAGAC TGCCAAGCTC CAGGATTTCA 1441 AATCCTTCCT GCTTAAGGAC TCAGAAACAA GTCAGCGTCT GGCCAACCTC AGGCAACGGG 1501 TGGAGCAGTT TGCCAGGGCC TTCCCCATGC CTGGTTTGAT GAGCATTGCC CAACTTTCTT 1561 GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC 1621 GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG 1681 TGGAAAGGAC GATGAAAGCC TCTTTCTGAA AGGGTCACGC GTTAAGTCga caatcaacct 1741 ctggattaca aaatttgtga aagatt