Transcript: Human NM_001166357.1

Homo sapiens serine hydroxymethyltransferase 2 (SHMT2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SHMT2 (6472)
Length:
2357
CDS:
332..1783

Additional Resources:

NCBI RefSeq record:
NM_001166357.1
NBCI Gene record:
SHMT2 (6472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034804 CCGGAGAGTTGTGGACTTTAT pLKO.1 1591 CDS 100% 13.200 18.480 N SHMT2 n/a
2 TRCN0000234657 GTCTGACGTCAAGCGGATATC pLKO_005 799 CDS 100% 10.800 15.120 N SHMT2 n/a
3 TRCN0000034805 CCGAATCAACTTTGCCGTGTT pLKO.1 1207 CDS 100% 4.050 5.670 N SHMT2 n/a
4 TRCN0000238795 CGGAGAGTTGTGGACTTTATA pLKO_005 1592 CDS 100% 15.000 12.000 N SHMT2 n/a
5 TRCN0000034806 CTTCGAGTCTATGCCCTATAA pLKO.1 835 CDS 100% 13.200 9.240 N SHMT2 n/a
6 TRCN0000234658 CTTCGAGTCTATGCCCTATAA pLKO_005 835 CDS 100% 13.200 9.240 N SHMT2 n/a
7 TRCN0000234656 ACAAGTACTCGGAGGGTTATC pLKO_005 549 CDS 100% 10.800 7.560 N SHMT2 n/a
8 TRCN0000234659 TAGGGCAAGAGCCAGGTATAG pLKO_005 1897 3UTR 100% 10.800 7.560 N SHMT2 n/a
9 TRCN0000034807 GCTCCAGGATTTCAAATCCTT pLKO.1 1660 CDS 100% 0.300 0.210 N SHMT2 n/a
10 TRCN0000034808 GAGGTGTGTGATGAAGTCAAA pLKO.1 983 CDS 100% 4.950 2.970 N SHMT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166357.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15588 pDONR223 0% 95.8% 95.8% None 0_1ins63 n/a
2 ccsbBroad304_15588 pLX_304 0% 95.8% 95.8% V5 0_1ins63 n/a
3 TRCN0000474289 CCGAACAGTAGAACGGTGCAACGC pLX_317 33.1% 95.8% 95.8% V5 0_1ins63 n/a
4 ccsbBroadEn_06947 pDONR223 100% 95.7% 95.8% None 0_1ins63;750G>A n/a
5 ccsbBroad304_06947 pLX_304 0% 95.7% 95.8% V5 0_1ins63;750G>A n/a
6 TRCN0000468229 ACCCCATGAGAACTTCAGATCCGG pLX_317 28% 95.7% 95.8% V5 0_1ins63;750G>A n/a
7 ccsbBroadEn_13952 pDONR223 100% 93.7% 93% None 0_1ins63;532_561del;1437delT n/a
8 ccsbBroad304_13952 pLX_304 0% 93.7% 93% V5 (not translated due to frame shift) 0_1ins63;532_561del;1437delT n/a
9 TRCN0000472686 TGAAAGCCTCTTTCTGAAAGGGTC pLX_317 16.7% 93.7% 93% V5 (not translated due to frame shift) 0_1ins63;532_561del;1437delT n/a
Download CSV