Construct: ORF TRCN0000472714
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007202.1_s317c1
- Derived from:
- ccsbBroadEn_01639
- DNA Barcode:
- CCACGTCTCCGTATCGGAGTGAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TAF9 (6880)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472714
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6880 | TAF9 | TATA-box binding protein as... | NM_001015892.1 | 100% | 100% | |
| 2 | human | 6880 | TAF9 | TATA-box binding protein as... | NM_003187.5 | 100% | 100% | |
| 3 | mouse | 108143 | Taf9 | TATA-box binding protein as... | NM_001015889.2 | 90.1% | 94.7% | (many diffs) |
| 4 | mouse | 108143 | Taf9 | TATA-box binding protein as... | NM_027139.5 | 90.1% | 94.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 858
- ORF length:
- 792
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtctggcaag acggcttctc ccaagagcat gccgaaagat gcacagatga 121 tggcacaaat cctgaaggat atggggatta cagaatatga gccaagagtt ataaatcaga 181 tgttggagtt tgccttccga tatgtgacca caattctaga tgatgcaaaa atttattcaa 241 gccatgctaa gaaagctact gttgatgcag atgatgtgcg attggcaatc cagtgccgcg 301 ctgatcagtc ttttacctct cctcccccaa gagatttttt attagatatt gcaaggcaaa 361 gaaatcaaac ccctttgcca ttgatcaagc catattcagg tcctaggttg ccacctgata 421 gatactgctt aacagctcca aactataggc tgaaatcttt aCAGAAAAAG GCATCAACTT 481 CTGCGGGAAG AATAACAGTC CCGCGGTTAA GTGTTGGTTC AGTTACTAGC AGACCAAGTA 541 CTCCCACACT AGGCACACCA ACCCCACAGA CCATGTCTGT TTCAACTAAA GTAGGGACTC 601 CCATGTCCCT CACAGGTCAA AGGTTTACAG TACAGATGCC TACTTCTCAG TCTCCAGCTG 661 TAAAAGCTTC AATTCCTGCA ACCTCAGCAG TTCAGAATGT TCTGATTAAT CCATCATTAA 721 TCGGGTCCAA AAACATTCTT ATTACCACTA ATATGATGTC ATCACAAAAT ACTGCCAATG 781 AATCATCAAA TGCATTGAAA AGAAAACGTG AAGATGATGA TGATGACGAT GATGATGATG 841 ATGACTATGA TAATCTGTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 901 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 961 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACCACGTC TCCGTATCGG 1021 AGTGAATACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt