Transcript: Mouse NM_001015889.2

Mus musculus TATA-box binding protein associated factor 9 (Taf9), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Taf9 (108143)
Length:
1248
CDS:
222..1016

Additional Resources:

NCBI RefSeq record:
NM_001015889.2
NBCI Gene record:
Taf9 (108143)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001015889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039270 CCGAGAGATTTCTTATTAGAT pLKO.1 483 CDS 100% 5.625 7.875 N Taf9 n/a
2 TRCN0000039269 CCATCGTTAATTGGGTCCAAA pLKO.1 867 CDS 100% 4.950 6.930 N Taf9 n/a
3 TRCN0000039271 CGAGTCAGCAAATGCACTGAA pLKO.1 929 CDS 100% 4.950 3.960 N Taf9 n/a
4 TRCN0000315351 ATATGAGCCAAGAGTTATAAA pLKO_005 311 CDS 100% 15.000 10.500 N TAF9 n/a
5 TRCN0000234261 ATCCATTGTACTACAAGTTAA pLKO_005 1056 3UTR 100% 13.200 9.240 N Gm12372 n/a
6 TRCN0000218013 CCATGTCTGTTTCAACTAAAG pLKO_005 727 CDS 100% 10.800 7.560 N Gm12372 n/a
7 TRCN0000234259 GATTGCCACCTGATAGGTATT pLKO_005 562 CDS 100% 10.800 7.560 N Gm12372 n/a
8 TRCN0000014572 GCCGAAAGATGCACAGATGAT pLKO.1 257 CDS 100% 4.950 3.465 N TAF9 n/a
9 TRCN0000039273 CCAGCCATGCTAAGAAAGCTA pLKO.1 394 CDS 100% 3.000 2.100 N Taf9 n/a
10 TRCN0000039272 GTTCAGTTTCTAGTAGACCAA pLKO.1 673 CDS 100% 2.640 1.848 N Taf9 n/a
11 TRCN0000244259 ATCAGGCCTGAAGTACGTTAA pLKO_005 161 5UTR 100% 10.800 5.400 Y Taf9 n/a
12 TRCN0000255328 CGATGATGATGACGATGATAA pLKO_005 965 CDS 100% 13.200 6.600 Y Sbpl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001015889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01639 pDONR223 100% 90.1% 94.7% None (many diffs) n/a
2 ccsbBroad304_01639 pLX_304 0% 90.1% 94.7% V5 (many diffs) n/a
3 TRCN0000472714 CCACGTCTCCGTATCGGAGTGAAT pLX_317 50.1% 90.1% 94.7% V5 (many diffs) n/a
Download CSV