Construct: ORF TRCN0000472727
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013900.1_s317c1
- Derived from:
- ccsbBroadEn_16063
- DNA Barcode:
- GCCTCAGACCGTAGCTCCGGCTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FAAP24 (91442)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472727
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 91442 | FAAP24 | FA core complex associated ... | NM_152266.5 | 99.6% | 100% | 417G>A;636G>A |
| 2 | human | 91442 | FAAP24 | FA core complex associated ... | XM_005259393.3 | 79.6% | 72.1% | (many diffs) |
| 3 | human | 91442 | FAAP24 | FA core complex associated ... | NM_001300978.2 | 55.5% | 55.8% | 0_1ins285;132G>A;351G>A |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 711
- ORF length:
- 645
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga aaagaacccc cctgatgata cgggccccgt gcacgtgcct ttggggcata 121 ttgtggccaa tgagaaatgg cgcgggtcac agctggcgca ggagatgcaa gggaaaatta 181 agctcatttt cgaggatggc ttgacaccag acttttatct gtcgaacaga tgctgcattc 241 tttatgtcac cgaagctgat ttggtggcag gaaatggcta cagaaagagg cttgttcggg 301 ttagaaattc caataatctt aaaggaattg tagtcgttga aaaaacccgg atgagtgaac 361 aatacttccc agccctacag aagtttactg tgctggacct tGGAATGGTG CTGCTTCCAG 421 TGGCCAGCCA GATGGAAGCA TCCTGCCTCG TCATCCAGTT GGTTCAAGAG CAAACCAAAG 481 AACCCAGTAA GAACCCTCTT CTCGGGAAGA AACGGGCCCT GCTGCTGTCT GAGCCTTCGC 541 TCCTTCGAAC CGTGCAGCAG ATCCCAGGAG TTGGAAAAGT TAAAGCTCCC CTTCTCCTCC 601 AGAAGTTTCC AAGCATCCAG CAACTGAGTA ATGCTTCCAT TGGGGAACTG GAGCAGGTGG 661 TCGGACAAGC AGTGGCACAG CAGATCCATG CCTTCTTCAC ACAGCCCAGG TGCCCAACTT 721 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 781 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 841 CTTGTGGAAA GGACGAGCCT CAGACCGTAG CTCCGGCTCA ACGCGTTAAG TCgacaatca 901 acctctggat tacaaaattt gtgaaagatt