Construct: ORF TRCN0000472773
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007991.1_s317c1
- Derived from:
- ccsbBroadEn_06331
- DNA Barcode:
- TCGTCCCTTAACTAGCCGTAGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GSTA4 (2941)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472773
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2941 | GSTA4 | glutathione S-transferase a... | NM_001512.4 | 99.8% | 99.5% | 13C>G |
| 2 | human | 2941 | GSTA4 | glutathione S-transferase a... | XM_005249035.4 | 99.8% | 99.5% | 13C>G |
| 3 | human | 2941 | GSTA4 | glutathione S-transferase a... | XM_011514534.3 | 83.3% | 79.2% | 0_1ins59;27_28ins52 |
| 4 | human | 2941 | GSTA4 | glutathione S-transferase a... | XM_011514535.3 | 83.3% | 79.2% | 0_1ins59;27_28ins52 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 732
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agcaagggcc aagctccact atcccaacgg aagaggccgg atggagtccg 121 tgagatgggt tttagctgcc gccggagtcg agtttgatga agaatttctg gaaacaaaag 181 aacagttgta caagttgcag gatggtaacc acctgctgtt ccaacaagtg cccatggttg 241 aaattgacgg gatgaagttg gtacagaccc gaagcattct ccactacata gcagacaagc 301 acaatctctt tggcaagaac ctcaaggaga gaaccctgat tgacatgtac gtggagggga 361 cactGGATCT GCTGGAACTG CTTATCATGC ATCCTTTCTT AAAACCAGAT GATCAGCAAA 421 AGGAAGTGGT TAACATGGCC CAGAAGGCTA TAATTAGATA CTTTCCTGTG TTTGAAAAGA 481 TTTTAAGGGG TCACGGACAA AGCTTTCTTG TTGGTAATCA GCTGAGCCTT GCAGATGTGA 541 TTTTACTCCA AACCATTTTA GCTCTAGAAG AGAAAATTCC TAATATCCTG TCTGCATTTC 601 CTTTCCTCCA GGAATACACA GTGAAACTAA GTAATATCCC TACAATTAAG AGATTCCTTG 661 AACCTGGCAG CAAGAAGAAG CCTCCCCCTG ATGAAATTTA TGTGAGAACC GTCTACAACA 721 TCTTTAGGCC ATACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 781 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 841 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCG TCCCTTAACT AGCCGTAGAA 901 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t