Transcript: Human XM_005249035.4

PREDICTED: Homo sapiens glutathione S-transferase alpha 4 (GSTA4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GSTA4 (2941)
Length:
1376
CDS:
190..858

Additional Resources:

NCBI RefSeq record:
XM_005249035.4
NBCI Gene record:
GSTA4 (2941)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249035.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155139 GCACAATCTCTTTGGCAAGAA pLKO.1 423 CDS 100% 4.950 6.930 N GSTA4 n/a
2 TRCN0000278247 GCACAATCTCTTTGGCAAGAA pLKO_005 423 CDS 100% 4.950 6.930 N GSTA4 n/a
3 TRCN0000151839 CTACAACATCTTTAGGCCATA pLKO.1 837 CDS 100% 4.050 5.670 N GSTA4 n/a
4 TRCN0000278248 CTACAACATCTTTAGGCCATA pLKO_005 837 CDS 100% 4.050 5.670 N GSTA4 n/a
5 TRCN0000156654 GCGTCTTTCTGCTCTCCTTAT pLKO.1 1196 3UTR 100% 10.800 7.560 N GSTA4 n/a
6 TRCN0000297181 GCGTCTTTCTGCTCTCCTTAT pLKO_005 1196 3UTR 100% 10.800 7.560 N GSTA4 n/a
7 TRCN0000156612 GCTCTGTCATGGTGCTATCTA pLKO.1 935 3UTR 100% 5.625 3.938 N GSTA4 n/a
8 TRCN0000278246 GCTCTGTCATGGTGCTATCTA pLKO_005 935 3UTR 100% 5.625 3.938 N GSTA4 n/a
9 TRCN0000155913 CTCCAGGAATACACAGTGAAA pLKO.1 730 CDS 100% 4.950 3.465 N GSTA4 n/a
10 TRCN0000154650 GAGAACCGTCTACAACATCTT pLKO.1 828 CDS 100% 4.950 3.465 N GSTA4 n/a
11 TRCN0000158336 CCACTACATAGCAGACAAGCA pLKO.1 405 CDS 100% 2.640 1.848 N GSTA4 n/a
12 TRCN0000297422 CCACTACATAGCAGACAAGCA pLKO_005 405 CDS 100% 2.640 1.848 N GSTA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249035.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06331 pDONR223 100% 99.8% 99.5% None 13C>G n/a
2 ccsbBroad304_06331 pLX_304 0% 99.8% 99.5% V5 13C>G n/a
3 TRCN0000472773 TCGTCCCTTAACTAGCCGTAGAAC pLX_317 55.1% 99.8% 99.5% V5 13C>G n/a
4 ccsbBroadEn_10866 pDONR223 100% 58.1% 58.1% None 1_279del n/a
5 ccsbBroad304_10866 pLX_304 0% 58.1% 58.1% V5 1_279del n/a
6 TRCN0000469476 CTTCATGACTGGGGAGCTCTAGGC pLX_317 100% 58.1% 58.1% V5 1_279del n/a
Download CSV