Construct: ORF TRCN0000472782
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019054.2_s317c1
- Derived from:
- ccsbBroadEn_14548
- DNA Barcode:
- AGTGGTTAACCAAGATATCAGGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BLK (640)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472782
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 640 | BLK | BLK proto-oncogene, Src fam... | NM_001715.3 | 100% | 100% | |
| 2 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543824.1 | 95.1% | 95.1% | 952_1029del |
| 3 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543825.3 | 95.1% | 95.1% | 952_1029del |
| 4 | human | 640 | BLK | BLK proto-oncogene, Src fam... | NM_001330465.2 | 85.9% | 85.9% | 0_1ins213 |
| 5 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543827.1 | 81.7% | 81.7% | 0_1ins213;739_816del |
| 6 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543828.3 | 62.7% | 51.1% | (many diffs) |
| 7 | human | 640 | BLK | BLK proto-oncogene, Src fam... | XM_011543829.3 | 62.5% | 51.2% | (many diffs) |
| 8 | mouse | 12143 | Blk | B lymphoid kinase | NM_007549.2 | 83.8% | 86.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1584
- ORF length:
- 1515
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggggctggta agtagcaaaa agccggacaa ggaaaagccg atcaaagaga 121 aggacaaggg ccaatggagc cccctgaagg tcagcgccca agacaaggac gccccgccac 181 tgccgcccct ggttgtcttc aaccacctta ctcctccacc gcccgatgaa cacctggatg 241 aagacaagca tttcgtggtg gctctgtatg actacaccgc tatgaatgat cgggacctgc 301 agatgctgaa gggggagaag ctacaggtcc tgaagggaac tggagactgg tggctggcca 361 ggtcactcgt cacaggaaga gaaggctatg tgcccagtaa ctttgtggcc cgagtggaga 421 gcctggaaat ggaaaggtgg ttctttagat cacagggtcg gaaggaggct gagaggcagc 481 ttcttgctcc aatcaacaag gccggctcct ttcttatcag agagagtgaa accaacaaag 541 gtgccttctc cctgtctgtg aaggatgtca ccacccaggg ggagctgatc aagcactata 601 agatccgctg cctggatgaa gggggctact acatctcccc ccggatcacc ttcccctcgc 661 tccaggccct ggtgcagcac tattctaaga agggggatgg tctatgccag aggctgaccc 721 tgccctgtgt gcgcccggcc ccgcagaatc cctgggccca ggatgaatgg gagatccccc 781 ggcagtctct caggctggtc aggaaactcg ggtctggaca attcggcgaa gtctggatgg 841 gttactacaa aaacaacatg aaggtggcca ttaagacgct gaaggaggga accatgtctc 901 cagaagcctt tctgggtgag gccaacgtga tgaaggctct gcagcacgag cggctggtcc 961 gactctacgc agtggtcacc aaggagccca tctacattgt caccgagtac atggccagag 1021 gatgcctgct ggatttcctg aagacagatg aagggagcag attgtcactc ccaaggctga 1081 ttgacatgtc ggcgcagatt gctgaaggga tggcatacat tgagcgcatg aattccatcc 1141 accgcgaccT GCGGGCGGCC AACATCCTGG TGTCTGAGGC CTTGTGCTGC AAAATTGCTG 1201 ATTTTGGCTT GGCTCGAATC ATCGACAGTG AATACACGGC CCAAGAGGGG GCCAAGTTCC 1261 CCATCAAGTG GACAGCCCCG GAAGCCATCC ACTTCGGGGT CTTCACCATC AAAGCAGACG 1321 TGTGGTCGTT TGGAGTCCTC CTGATGGAAG TTGTCACTTA TGGGCGGGTG CCATACCCAG 1381 GGATGAGCAA CCCCGAGGTC ATCCGCAACC TGGAGCGCGG CTACCGCATG CCGCGCCCCG 1441 ACACCTGCCC GCCCGAGCTG TACCGCGGCG TCATCGCCGA GTGCTGGCGC AGCCGGCCCG 1501 AGGAGCGGCC CACCTTCGAG TTCCTGCAGT CGGTGCTGGA GGACTTCTAC ACGGCCACCG 1561 AGCGGCAGTA CGAGCTGCAG CCCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1621 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1681 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAGTG GTTAACCAAG 1741 ATATCAGGGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt