Construct: ORF TRCN0000472869
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009807.1_s317c1
- Derived from:
- ccsbBroadEn_02923
- DNA Barcode:
- GTCAGGAGCGCGGGCATCAGTATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PHF19 (26147)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472869
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26147 | PHF19 | PHD finger protein 19 | NM_001009936.3 | 100% | 100% | |
| 2 | human | 26147 | PHF19 | PHD finger protein 19 | NM_001286843.2 | 62.8% | 59% | 363_364insGGTTACCACCAGCA;390_391ins217 |
| 3 | human | 26147 | PHF19 | PHD finger protein 19 | XM_011518516.2 | 49.2% | 41.7% | (many diffs) |
| 4 | human | 26147 | PHF19 | PHD finger protein 19 | XM_011518515.2 | 45.3% | 38.4% | (many diffs) |
| 5 | human | 26147 | PHF19 | PHD finger protein 19 | XM_017014613.1 | 43.1% | 36.6% | (many diffs) |
| 6 | human | 26147 | PHF19 | PHD finger protein 19 | XM_011518511.2 | 40.4% | 34.3% | (many diffs) |
| 7 | human | 26147 | PHF19 | PHD finger protein 19 | NM_015651.3 | 33% | 28.1% | (many diffs) |
| 8 | human | 26147 | PHF19 | PHD finger protein 19 | XM_005251906.3 | 33% | 28.1% | (many diffs) |
| 9 | human | 26147 | PHF19 | PHD finger protein 19 | XM_011518509.3 | 33% | 28.1% | (many diffs) |
| 10 | human | 26147 | PHF19 | PHD finger protein 19 | XM_017014612.2 | 33% | 28.1% | (many diffs) |
| 11 | human | 26147 | PHF19 | PHD finger protein 19 | NM_001286840.1 | 31.9% | 27.2% | (many diffs) |
| 12 | human | 26147 | PHF19 | PHD finger protein 19 | XR_929758.3 | 12.5% | (many diffs) | |
| 13 | mouse | 74016 | Phf19 | PHD finger protein 19 | XM_006498384.3 | 64.3% | 63.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 687
- ORF length:
- 621
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaatcgagct ctggatccag ggactcggga ctcctatggt gccaccagcc 121 acctccccaa caagggggcc ctggcgaagg tcaagaacaa cttcaaagac ttgatgtcca 181 aactgacgga gggccagtat gtgctgtgcc ggtggacaga tggcctgtac tacctcggga 241 agatcaagag ggtcagcagc tctaagcaaa gctgcctcgt gactttcgaa gataattcca 301 aatactgggt cctatggaag gacatacagc atgccggtgt tccaggagag gagcccaagt 361 gcaacatctg cctagggaag acatcagggc cgctgaatga gatcctcatc tgcgggaagt 421 gtggcctggg ttaccaccag cagtgccaca tccccatagc gggcagtgct gaccagcccc 481 tgctcacacc ttggttctgc cgacgctgca tcttcgcact GGCTGTGCGG GTGAGCCTTC 541 CATCCTCCCC AGTCCCTGCC TCTCCTGCCT CCTCCAGTGG GGCAGACCAG AGACTCCCAT 601 CACAGAGTCT GAGCTCCAAG CAGAAGGGCC ACACCTGGGC TTTGGAGACA GATAGCGCCT 661 CTGCCACTGT CCTTGGCCAG GATTTGTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 721 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 781 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGTCAGGAG 841 CGCGGGCATC AGTATAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 901 aagatt