Transcript: Human XM_017014612.2

PREDICTED: Homo sapiens PHD finger protein 19 (PHF19), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF19 (26147)
Length:
4277
CDS:
287..2029

Additional Resources:

NCBI RefSeq record:
XM_017014612.2
NBCI Gene record:
PHF19 (26147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017014612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108186 CCTCGTGACTTTCGAAGATAA pLKO.1 496 CDS 100% 13.200 18.480 N PHF19 n/a
2 TRCN0000359827 CTCGTGACTTTCGAAGATAAT pLKO_005 497 CDS 100% 13.200 18.480 N PHF19 n/a
3 TRCN0000108185 CCTGAAATGGACAATCACTTT pLKO.1 3221 3UTR 100% 4.950 6.930 N PHF19 n/a
4 TRCN0000108188 GCCACACATTTGAGAGCATCA pLKO.1 1842 CDS 100% 4.050 3.240 N PHF19 n/a
5 TRCN0000359828 CAACGCTCTGAACAGTTATAA pLKO_005 1228 CDS 100% 15.000 10.500 N PHF19 n/a
6 TRCN0000108189 CCCACCTCAAGTCATCTATCA pLKO.1 1884 CDS 100% 4.950 3.465 N PHF19 n/a
7 TRCN0000108187 CCTGGCTAGCATATTTGACTT pLKO.1 1540 CDS 100% 4.950 3.465 N PHF19 n/a
8 TRCN0000367884 ACCACCTGGCTAGCATATTTG pLKO_005 1536 CDS 100% 13.200 7.920 N PHF19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017014612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02924 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02924 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465955 CGAGCAGACAGACTAGGCTGCGCA pLX_317 22% 100% 100% V5 n/a
4 ccsbBroadEn_02923 pDONR223 100% 33% 28.1% None (many diffs) n/a
5 ccsbBroad304_02923 pLX_304 0% 33% 28.1% V5 (many diffs) n/a
6 TRCN0000472869 GTCAGGAGCGCGGGCATCAGTATA pLX_317 27.6% 33% 28.1% V5 (many diffs) n/a
Download CSV