Construct: ORF TRCN0000472879
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015193.1_s317c1
- Derived from:
- ccsbBroadEn_07856
- DNA Barcode:
- AAAACCCCTAGATCTGTACGTACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MLC1 (23209)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472879
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23209 | MLC1 | modulator of VRAC current 1 | NM_015166.3 | 99.9% | 99.7% | 74C>A |
| 2 | human | 23209 | MLC1 | modulator of VRAC current 1 | NM_139202.2 | 99.9% | 99.7% | 74C>A |
| 3 | human | 23209 | MLC1 | modulator of VRAC current 1 | XM_017028671.1 | 99.9% | 99.7% | 74C>A |
| 4 | human | 23209 | MLC1 | modulator of VRAC current 1 | XM_011530678.2 | 85.3% | 85.1% | 74C>A;894_895ins165 |
| 5 | human | 23209 | MLC1 | modulator of VRAC current 1 | XR_001755181.2 | 49.1% | 1_273del;347C>A;1405_2299del | |
| 6 | human | 23209 | MLC1 | modulator of VRAC current 1 | XR_001755180.2 | 44.6% | 1_505del;579C>A;1637_2531del | |
| 7 | mouse | 170790 | Mlc1 | megalencephalic leukoenceph... | NM_133241.2 | 82.1% | 87.4% | (many diffs) |
| 8 | mouse | 170790 | Mlc1 | megalencephalic leukoenceph... | XM_006520545.3 | 77.3% | 82.3% | (many diffs) |
| 9 | mouse | 170790 | Mlc1 | megalencephalic leukoenceph... | XM_006520544.3 | 76.2% | 81.1% | (many diffs) |
| 10 | mouse | 170790 | Mlc1 | megalencephalic leukoenceph... | XM_011245483.2 | 76.2% | 81.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ccaggagcca ttcagagagg agctggccta tgaccggatg cccacgctgg 121 agcggggccg gcaagaccac gccagctatg ccccagacgc gaagccgagc gacctgcagc 181 tgtcgaagag actgcccccc tgcttcagcc acaagacgtg ggtcttctct gtgctgatgg 241 ggagctgcct cctggtgacc tcggggtttt cgctgtacct ggggaacgtg ttcccggctg 301 agatggatta cttgcgctgt gctgcaggct cttgcatccc ctcggcaatt gtgagcttca 361 ccgtctccag gaggaacgcc aatgtgattc ccaactttca gatattgttt gtttccacgt 421 ttgctgtgac cactacgtgt ttaatttggt ttggatgcaa actagtcctg aacccatcag 481 caataaacat caacttcaac ctcatcctgc tgctcctgct ggagctgctc atggcggcca 541 cggtgatcat cgctgcacgg tccagcgagg aggactgcaa gaaaaagaag ggctccatgt 601 ctgacagcgc caacattctg gacgaagtgc catttcctgc tcgggtcctg aaatcttact 661 cagtcgtcga ggtaatcgca ggcatctctg ccgtccTCGG GGGGATCATT GCCCTGAACG 721 TGGATGACTC AGTTTCAGGC CCACACCTCT CAGTGACGTT CTTTTGGATC CTAGTGGCCT 781 GCTTTCCAAG TGCCATTGCC AGTCATGTGG CAGCAGAGTG TCCCAGCAAG TGTCTGGTGG 841 AGGTCCTGAT TGCCATAAGC AGCCTCACGT CTCCGCTGCT GTTCACAGCC TCTGGATATC 901 TGTCATTCAG CATCATGAGA ATCGTGGAGA TGTTTAAGGA TTACCCGCCA GCCATAAAAC 961 CATCCTACGA TGTGCTGCTG CTGCTGCTGC TGCTAGTGCT CCTGCTGCAG GCCGGCCTCA 1021 ACACGGGCAC CGCCATCCAG TGCGTGCGCT TCAAGGTCAG TGCAAGGCTG CAGGGTGCAT 1081 CCTGGGACAC CCAGAACGGC CCGCAGGAGC GCCTGGCTGG GGAGGTGGCC AGGAGCCCCC 1141 TGAAGGAGTT CGACAAGGAG AAAGCCTGGA GAGCCGTCGT GGTGCAAATG GCCCAGTGCC 1201 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1261 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1321 ATATATCTTG TGGAAAGGAC GAAAAACCCC TAGATCTGTA CGTACCACGC GTTAAGTCga 1381 caatcaacct ctggattaca aaatttgtga aagatt