Transcript: Human XM_017028671.1

PREDICTED: Homo sapiens modulator of VRAC current 1 (MLC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MLC1 (23209)
Length:
3388
CDS:
63..1196

Additional Resources:

NCBI RefSeq record:
XM_017028671.1
NBCI Gene record:
MLC1 (23209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423104 TTACTCAGTCGTCGAGGTAAT pLKO_005 653 CDS 100% 10.800 15.120 N MLC1 n/a
2 TRCN0000425755 CACCTCTCAGTGACGTTCTTT pLKO_005 741 CDS 100% 5.625 7.875 N MLC1 n/a
3 TRCN0000060081 GCCAATGTGATTCCCAACTTT pLKO.1 375 CDS 100% 5.625 7.875 N MLC1 n/a
4 TRCN0000060082 CCTGAACCCATCAGCAATAAA pLKO.1 464 CDS 100% 15.000 10.500 N MLC1 n/a
5 TRCN0000060079 CGTGGAGATGTTTAAGGATTA pLKO.1 920 CDS 100% 10.800 7.560 N MLC1 n/a
6 TRCN0000437729 AGTCAGCCCAGTGGGATCTTA pLKO_005 1652 3UTR 100% 5.625 3.938 N MLC1 n/a
7 TRCN0000060078 CCCAACTTTCAGATATTGTTT pLKO.1 387 CDS 100% 5.625 3.938 N MLC1 n/a
8 TRCN0000060080 CGTGTTTAATTTGGTTTGGAT pLKO.1 433 CDS 100% 3.000 2.100 N MLC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07856 pDONR223 100% 99.9% 99.7% None 74C>A n/a
2 ccsbBroad304_07856 pLX_304 0% 99.9% 99.7% V5 74C>A n/a
3 TRCN0000472879 AAAACCCCTAGATCTGTACGTACC pLX_317 44.3% 99.9% 99.7% V5 74C>A n/a
Download CSV