Construct: ORF TRCN0000472905
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007989.1_s317c1
- Derived from:
- ccsbBroadEn_06479
- DNA Barcode:
- TAGATCAGCACTATTCTTGTCTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNJ10 (3766)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472905
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3766 | KCNJ10 | potassium inwardly rectifyi... | NM_002241.5 | 99.7% | 99.4% | 248G>T;426G>A;1084A>G |
| 2 | mouse | 16513 | Kcnj10 | potassium inwardly-rectifyi... | NM_001039484.1 | 89.3% | 98.6% | (many diffs) |
| 3 | mouse | 16513 | Kcnj10 | potassium inwardly-rectifyi... | XM_006496677.3 | 89.3% | 98.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1203
- ORF length:
- 1137
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac gtcagttgcc aaggtgtatt acagtcagac cactcagaca gaaagccggc 121 ccctaatggg cccagggata cgacggcgga gagtcctgac aaaagatggt cgcagcaacg 181 tgagaatgga gcacattgcc gacaagcgct tcctctacct caaggacctg tggacaacct 241 tcattgacat gcagtggcgc tacaagcttc tgctcttctc tgcgaccttt gcaggcacat 301 ggttcctctt tgtcgtggtg tggtatctgg tagctgtggc acatggggac ctgctggagc 361 tggacccccc ggccaaccac accccctgtg tggtacaggt gcacacactc actggagcct 421 tcctcttctc ccttgaatcc caaaccacca ttggctatgg cttccgctac atcagtgagg 481 aatgtccact agccattgtg cttcttattg cccagctggt gctcaccacc atcctggaaa 541 tcttcatcac aggtaccttc ctggcgaaga ttgcccggcc caagaagcgg gctgagacca 601 ttcgtttcag ccagcatgca gttgtggcct cccacaatgg caagccctgc ctcatgatcc 661 gagttgccaa tatgcgcaaa agcctcctca ttggctgcca ggtgacagga aaactgcttc 721 agacccacca aaccaaggaa ggggagaaca tccggctcaa ccaggtcaat gtgactttcc 781 aagtagacac agcctctgac agccccttcc ttattctacc ccttaccttc tatcatgtgg 841 tagatgagac cagtcccttg aaagatctcc ctcttcgcag tggtgagggt gactttgagc 901 tggtgctgat cctaagtggg acagtggagt ccaccagtgc cacctgtcag gtgcgcactt 961 cctacctgcc agaggagatc ctttggggct acgagttcac acctgccatc tcactgtcag 1021 ccagtggtaa atacatagct gactttagcc tttttgacca agttgtgaaa gtggcctctc 1081 ctagtggcct ccgtgacagc actgtacgct acggagaccc tgaaaagctc aagttggagg 1141 agtcattaGG GGAGCAAGCT GAGAAGGAGG GCAGTGCCCT TAGTGTGCGC ATCAGCAATG 1201 TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1261 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1321 GGCTTTATAT ATCTTGTGGA AAGGACGATA GATCAGCACT ATTCTTGTCT ATACGCGTTA 1381 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt