Transcript: Mouse XM_006496677.3

PREDICTED: Mus musculus potassium inwardly-rectifying channel, subfamily J, member 10 (Kcnj10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kcnj10 (16513)
Length:
5262
CDS:
98..1237

Additional Resources:

NCBI RefSeq record:
XM_006496677.3
NBCI Gene record:
Kcnj10 (16513)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496677.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069571 CGTTTCCTCTACCTCAAGGAT pLKO.1 239 CDS 100% 3.000 4.200 N Kcnj10 n/a
2 TRCN0000069569 CAGACAAAGGAGGGTGAGAAT pLKO.1 761 CDS 100% 4.950 3.465 N Kcnj10 n/a
3 TRCN0000069568 CGACCTTCATTGACATGCAAT pLKO.1 267 CDS 100% 4.950 3.465 N Kcnj10 n/a
4 TRCN0000069570 GCAAATACATAGCTGACTTCA pLKO.1 1059 CDS 100% 4.950 3.465 N Kcnj10 n/a
5 TRCN0000069572 GCTCAAGTTGGAGGAGTCATT pLKO.1 1159 CDS 100% 4.950 3.465 N Kcnj10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496677.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00895 pDONR223 100% 89.6% 99.2% None (many diffs) n/a
2 ccsbBroad304_00895 pLX_304 0% 89.6% 99.2% V5 (many diffs) n/a
3 TRCN0000477614 GCGAACACCGCTCTGTTCGCTCTC pLX_317 22.9% 89.6% 99.2% V5 (many diffs) n/a
4 ccsbBroadEn_06479 pDONR223 100% 89.4% 98.9% None (many diffs) n/a
5 ccsbBroad304_06479 pLX_304 0% 89.4% 98.9% V5 (many diffs) n/a
6 TRCN0000472905 TAGATCAGCACTATTCTTGTCTAT pLX_317 5.6% 89.3% 98.6% V5 (many diffs) n/a
Download CSV