Construct: ORF TRCN0000472917
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007118.1_s317c1
- Derived from:
- ccsbBroadEn_11100
- DNA Barcode:
- TGTCTACTGTCACCTCCATCATCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RGS3 (5998)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472917
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5998 | RGS3 | regulator of G protein sign... | NM_001276262.2 | 87.3% | 86.9% | 0_1ins72;35A>G |
| 2 | human | 5998 | RGS3 | regulator of G protein sign... | NM_134427.2 | 87.3% | 86.9% | 0_1ins72;35A>G |
| 3 | human | 5998 | RGS3 | regulator of G protein sign... | NM_144489.3 | 61.6% | 61.4% | 1_357del;464A>G |
| 4 | human | 5998 | RGS3 | regulator of G protein sign... | NM_001276260.2 | 35.5% | 33.3% | (many diffs) |
| 5 | human | 5998 | RGS3 | regulator of G protein sign... | NM_001282922.2 | 35.5% | 33.3% | (many diffs) |
| 6 | human | 5998 | RGS3 | regulator of G protein sign... | NM_001351526.2 | 35.5% | 33.3% | (many diffs) |
| 7 | human | 5998 | RGS3 | regulator of G protein sign... | NM_001322215.2 | 34.3% | 32.2% | (many diffs) |
| 8 | human | 5998 | RGS3 | regulator of G protein sign... | NM_001276261.1 | 31.4% | 29.2% | (many diffs) |
| 9 | human | 5998 | RGS3 | regulator of G protein sign... | NM_130795.4 | 20.1% | 18.8% | (many diffs) |
| 10 | human | 5998 | RGS3 | regulator of G protein sign... | NM_001282923.2 | 17% | 15.9% | (many diffs) |
| 11 | human | 5998 | RGS3 | regulator of G protein sign... | NM_144488.6 | 15.4% | 14.4% | (many diffs) |
| 12 | mouse | 50780 | Rgs3 | regulator of G-protein sign... | XM_017320308.1 | 87.3% | 92.7% | (many diffs) |
| 13 | mouse | 50780 | Rgs3 | regulator of G-protein sign... | XM_006538072.3 | 75.6% | 80.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 642
- ORF length:
- 576
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ccgaggcatg tacctcactc gcaacgggaa cctgcagagg cgacacacga 121 tgaaggaagc caaggacatg aagaacaagc tggggatctt cagacggcgg agtgagtccc 181 ctggagcccc tcccgcgggc aaggcagaca aaatgatgaa gtcattcaag cccacctcag 241 aggaagccct caagtggggc gagtccttgg agaagctgct ggttcacaaa tacgggttag 301 cagtgttcca agccttcctt cgcactgagt tcagtgagga gaatctggag ttctggttgg 361 cttgtgagga cttcaagaag gtcaagtcac agtccaagat ggcatccaag gccaagaaga 421 tctttgctga atacatcgcg atccaggcat gcaaggaggt caacctggac tcctacacgc 481 gggagcacac caaggacaac ctgcagagcg tcacgcgggg ctgcttcgac ctggcacaga 541 agcgcatctt cgggctcatg gaaaaggact cgtaccctcg ctttctccgt tcTGACCTCT 601 ACCTGGACCT TATTAACCAG AAGAAGATGA GTCCCCCGCT TTACCCAACT TTCTTGTACA 661 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 721 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 781 AGGACGATGT CTACTGTCAC CTCCATCATC CACGCGTTAA GTCgacaatc aacctctgga 841 ttacaaaatt tgtgaaagat t