Transcript: Human NM_001276260.2

Homo sapiens regulator of G protein signaling 3 (RGS3), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
RGS3 (5998)
Length:
2653
CDS:
309..1868

Additional Resources:

NCBI RefSeq record:
NM_001276260.2
NBCI Gene record:
RGS3 (5998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244890 TGGACAGACGGATAGACATAC pLKO_005 1982 3UTR 100% 10.800 15.120 N RGS3 n/a
2 TRCN0000001766 CAGACGGATAGACATACGGAA pLKO.1 1986 3UTR 100% 2.640 3.696 N RGS3 n/a
3 TRCN0000001762 GTTAGCAGTGTTCCAAGCCTT pLKO.1 1520 CDS 100% 2.640 3.696 N RGS3 n/a
4 TRCN0000001764 CTTTCTCCGTTCTGACCTCTA pLKO.1 1805 CDS 100% 4.050 3.240 N RGS3 n/a
5 TRCN0000244889 ACCTCTACCTGGACCTTATTA pLKO_005 1819 CDS 100% 15.000 10.500 N RGS3 n/a
6 TRCN0000001763 CCTCTACCTGGACCTTATTAA pLKO.1 1820 CDS 100% 15.000 10.500 N RGS3 n/a
7 TRCN0000244887 AGAAGCTGCTGGTTCACAAAT pLKO_005 1495 CDS 100% 13.200 9.240 N RGS3 n/a
8 TRCN0000257261 CAAGAAGATCTTTGCTGAATA pLKO_005 1637 CDS 100% 13.200 9.240 N RGS3 n/a
9 TRCN0000001765 CTGGTTCACAAATACGGGTTA pLKO.1 1503 CDS 100% 4.050 2.835 N RGS3 n/a
10 TRCN0000244888 TACCCTCGCTTTCTCCGTTCT pLKO_005 1797 CDS 100% 0.000 0.000 N RGS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06862 pDONR223 100% 56.5% 56.4% None 0_1ins1194;137A>G n/a
2 ccsbBroad304_06862 pLX_304 0% 56.5% 56.4% V5 0_1ins1194;137A>G n/a
3 TRCN0000468623 AGCACTGCGTGATGATGACGAAGT pLX_317 15% 56.5% 56.4% V5 0_1ins1194;137A>G n/a
4 ccsbBroadEn_11100 pDONR223 100% 35.5% 33.3% None (many diffs) n/a
5 ccsbBroad304_11100 pLX_304 0% 35.5% 33.3% V5 (many diffs) n/a
6 TRCN0000472917 TGTCTACTGTCACCTCCATCATCC pLX_317 10% 35.5% 33.3% V5 (many diffs) n/a
Download CSV