Construct: ORF TRCN0000473171
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012242.1_s317c1
- Derived from:
- ccsbBroadEn_05067
- DNA Barcode:
- CTTTGAGGATATAGGCCCGCGGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- THAP6 (152815)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473171
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 152815 | THAP6 | THAP domain containing 6 | NM_144721.6 | 100% | 100% | |
2 | human | 152815 | THAP6 | THAP domain containing 6 | XM_011531666.2 | 100% | 100% | |
3 | human | 152815 | THAP6 | THAP domain containing 6 | XM_011531667.3 | 100% | 100% | |
4 | human | 152815 | THAP6 | THAP domain containing 6 | XM_005262772.3 | 81.5% | 81.5% | 0_1ins123 |
5 | human | 152815 | THAP6 | THAP domain containing 6 | NM_001317791.2 | 81% | 81% | 288_289ins126 |
6 | human | 152815 | THAP6 | THAP domain containing 6 | XM_017007800.1 | 81% | 81% | 288_289ins126 |
7 | human | 152815 | THAP6 | THAP domain containing 6 | XM_006714109.4 | 71.7% | 62.1% | (many diffs) |
8 | human | 152815 | THAP6 | THAP domain containing 6 | XM_005262774.4 | 69.9% | 63.5% | (many diffs) |
9 | human | 152815 | THAP6 | THAP domain containing 6 | XM_017007801.2 | 65% | 63% | (many diffs) |
10 | mouse | 381650 | Thap6 | THAP domain containing 6 | NR_028429.1 | 15.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 732
- ORF length:
- 666
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gaaatgctgc tccgccattg gatgtgcttc tcgctgcttg ccaaattcga 121 agttaaaagg actgacattt cacgtattcc ccacagatga aaacatcaaa aggaaatggg 181 tattagcaat gaaaagactt gatgtgaatg cagccggcat ttgggagcct aaaaaaggag 241 atgtgttgtg ttcgaggcac tttaagaaga cagattttga cagaagtgct ccaaatatta 301 aactgaaacc tggagtcata ccttctatct ttgattctcc atatcaccta caggggaaaa 361 gagaaaaact tcattGTAGA AAAAACTTCA CCCTCAAAAC CGTTCCAGCC ACTAACTACA 421 ATCACCATCT TGTTGGTGCT TCCTCATGTA TTGAAGAATT CCAATCCCAG TTCATTTTTG 481 AACATAGCTA CAGTGTAATG GACAGTCCAA AGAAACTTAA GCATAAATTA GATCATGTGA 541 TCGGCGAGCT AGAGGATACA AAGGAAAGTC TACGGAATGT TTTAGACCGA GAAAAACGTT 601 TTCAGAAATC ATTGAGGAAG ACAATCAGGG AATTAAAGGA TGAATGTCTG ATCAGCCAAG 661 AAACAGCAAA TAGACTGGAC ACTTTCTGTT GGGACTGTTG TCAGGAGAGC ATAGAACAGG 721 ACTATATTTC ATGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 781 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 841 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTT TGAGGATATA GGCCCGCGGC 901 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t