Transcript: Human XM_011531666.2

PREDICTED: Homo sapiens THAP domain containing 6 (THAP6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THAP6 (152815)
Length:
4026
CDS:
546..1214

Additional Resources:

NCBI RefSeq record:
XM_011531666.2
NBCI Gene record:
THAP6 (152815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011531666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134636 GCTTCCTCATGTATTGAAGAA pLKO.1 918 CDS 100% 4.950 6.930 N THAP6 n/a
2 TRCN0000322672 GCTTCCTCATGTATTGAAGAA pLKO_005 918 CDS 100% 4.950 6.930 N THAP6 n/a
3 TRCN0000322674 GATTCAATCCAAGGTGCTTTA pLKO_005 1673 3UTR 100% 10.800 8.640 N THAP6 n/a
4 TRCN0000137286 GACTGTTGTCAGGAGAGCATA pLKO.1 1173 CDS 100% 4.950 3.465 N THAP6 n/a
5 TRCN0000134720 GAGGATACAAAGGAAAGTCTA pLKO.1 1032 CDS 100% 4.950 3.465 N THAP6 n/a
6 TRCN0000322673 GAGGATACAAAGGAAAGTCTA pLKO_005 1032 CDS 100% 4.950 3.465 N THAP6 n/a
7 TRCN0000134810 CCTAATGGAAAGTTTGGGTAT pLKO.1 3128 3UTR 100% 4.050 2.835 N THAP6 n/a
8 TRCN0000133807 CCTTCTATCTTTGATTCTCCA pLKO.1 801 CDS 100% 2.640 1.848 N THAP6 n/a
9 TRCN0000322603 CCTTCTATCTTTGATTCTCCA pLKO_005 801 CDS 100% 2.640 1.848 N THAP6 n/a
10 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2956 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011531666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05067 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05067 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473171 CTTTGAGGATATAGGCCCGCGGCC pLX_317 53.4% 100% 100% V5 n/a
Download CSV