Construct: ORF TRCN0000473242
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001241.1_s317c1
- Derived from:
- ccsbBroadEn_04448
- DNA Barcode:
- CATTCCGAAGATATCCTACCCCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB2B (84932)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473242
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84932 | RAB2B | RAB2B, member RAS oncogene ... | NM_032846.4 | 100% | 100% | |
| 2 | human | 84932 | RAB2B | RAB2B, member RAS oncogene ... | NM_001163380.2 | 78.7% | 78.7% | 0_1ins138 |
| 3 | human | 84932 | RAB2B | RAB2B, member RAS oncogene ... | XM_017021710.1 | 75.5% | 72.6% | (many diffs) |
| 4 | human | 84932 | RAB2B | RAB2B, member RAS oncogene ... | XM_017021712.1 | 67.1% | 64.8% | (many diffs) |
| 5 | human | 84932 | RAB2B | RAB2B, member RAS oncogene ... | NR_028074.2 | 20.7% | 1_87del;272_273ins44;692_2870del | |
| 6 | mouse | 76338 | Rab2b | RAB2B, member RAS oncogene ... | NM_172601.3 | 91.4% | 94.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 714
- ORF length:
- 648
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ttatgcttat ctcttcaagt atatcatcat cggagacaca ggtgtgggga 121 agtcatgtct cctcctgcag tttacagata agcggttcca gcctgtccac gacctcacaa 181 taggtgtgga gtttggagct cgtatggtca acattgatgg aaaacaaatc aaactgcaaa 241 tctgggatac ggctgggcaa gaatccttcc gttctatcac ccgttcctac tacaggggag 301 cagctggagc actgctggtg tacgacatta caaggcgtga aaccttcaac caccTGACCT 361 CATGGTTAGA GGATGCCCGG CAGCACTCTA GTTCCAACAT GGTTATCATG CTCATTGGGA 421 ATAAGAGTGA CCTAGAGTCC CGCAGGGATG TGAAGAGAGA AGAAGGAGAG GCCTTTGCTA 481 GGGAGCATGG ACTTATATTC ATGGAAACTT CAGCCAAAAC AGCCTGCAAT GTTGAAGAGG 541 CCTTCATTAA CACAGCCAAA GAAATATATA GGAAGATCCA GCAGGGTTTA TTTGATGTCC 601 ACAATGAGGC AAATGGCATC AAGATTGGGC CCCAACAGTC AATTTCAACA TCAGTGGGAC 661 CCAGTGCCTC CCAGCGGAAC TCTCGTGACA TAGGGTCCAA CTCTGGCTGC TGCTGCCCAA 721 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 781 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 841 TATCTTGTGG AAAGGACGAC ATTCCGAAGA TATCCTACCC CCAACGCGTT AAGTCgacaa 901 tcaacctctg gattacaaaa tttgtgaaag att