Transcript: Human NM_032846.4

Homo sapiens RAB2B, member RAS oncogene family (RAB2B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RAB2B (84932)
Length:
2914
CDS:
88..738

Additional Resources:

NCBI RefSeq record:
NM_032846.4
NBCI Gene record:
RAB2B (84932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_032846.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233287 AGCGGAACTCTCGTGACATAG pLKO_005 695 CDS 100% 10.800 15.120 N RAB2B n/a
2 TRCN0000233285 CGACATTACAAGGCGTGAAAC pLKO_005 345 CDS 100% 10.800 15.120 N RAB2B n/a
3 TRCN0000047856 GCTCGTATGGTCAACATTGAT pLKO.1 220 CDS 100% 5.625 7.875 N RAB2B n/a
4 TRCN0000047855 GCAGCACTCTAGTTCCAACAT pLKO.1 402 CDS 100% 4.950 6.930 N RAB2B n/a
5 TRCN0000047854 CCTCACAATAGGTGTGGAGTT pLKO.1 195 CDS 100% 4.050 5.670 N RAB2B n/a
6 TRCN0000233288 GCCCTACTCTCCACTAATTAT pLKO_005 2154 3UTR 100% 15.000 12.000 N RAB2B n/a
7 TRCN0000233286 TAGGGAGCATGGACTTATATT pLKO_005 501 CDS 100% 15.000 10.500 N RAB2B n/a
8 TRCN0000047857 GCTAGGGAGCATGGACTTATA pLKO.1 499 CDS 100% 13.200 9.240 N RAB2B n/a
9 TRCN0000238813 GAGCTCGTATGGTCAACATTG pLKO_005 218 CDS 100% 10.800 7.560 N RAB2B n/a
10 TRCN0000047853 GCCTTCATTAACACAGCCAAA pLKO.1 562 CDS 100% 4.050 2.835 N RAB2B n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1516 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1207 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_032846.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04448 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04448 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473242 CATTCCGAAGATATCCTACCCCCA pLX_317 55.3% 100% 100% V5 n/a
4 ccsbBroadEn_10275 pDONR223 100% 69.9% 66.2% None 1_151del;186_229del n/a
5 ccsbBroad304_10275 pLX_304 0% 69.9% 66.2% V5 1_151del;186_229del n/a
6 TRCN0000468323 TTTGACTGTAATAAATGTTTGGAG pLX_317 84.3% 69.9% 66.2% V5 1_151del;186_229del n/a
Download CSV