Construct: ORF TRCN0000473253
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001559.1_s317c1
- Derived from:
- ccsbBroadEn_06675
- DNA Barcode:
- TGACTGTTTCGAACAGCACGCGGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC22A18 (5002)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473253
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5002 | SLC22A18 | solute carrier family 22 me... | NM_002555.6 | 99.8% | 99.7% | 35G>A;234A>G |
| 2 | human | 5002 | SLC22A18 | solute carrier family 22 me... | NM_183233.3 | 99.8% | 99.7% | 35G>A;234A>G |
| 3 | human | 5002 | SLC22A18 | solute carrier family 22 me... | NM_001315501.1 | 83.1% | 83.1% | 1_255del;290G>A;489A>G |
| 4 | human | 5002 | SLC22A18 | solute carrier family 22 me... | NM_001315502.2 | 76.7% | 76.6% | 35G>A;234A>G;241_242ins294 |
| 5 | human | 5002 | SLC22A18 | solute carrier family 22 me... | XM_011520141.2 | 57.5% | 56.5% | (many diffs) |
| 6 | human | 5002 | SLC22A18 | solute carrier family 22 me... | XM_011520142.2 | 57.3% | 56.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1338
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gggagctcgg gctcccaggg accagggcca gtcccccggc aggatgagcg 121 ctctaggccg gtcctcggtc atcttgctta cctacgtgct ggccgccaca gaacttacct 181 gcctcttcat gcagttctcc atcgtgccat acctgtctcg gaaactgggc ctggattcca 241 ttgccttcgg ctacctgcaa accaccttcg gggtgctgca gctgctgggc gggccggtgt 301 ttggcaggtt cgcagaccag cgcggggcgc gggcggcgct cacgctctcc ttcctggctg 361 ccttggcgct ctacctgctc ctggcggccg cctccagccc ggccctgccc ggggtctacc 421 tgctcttcgc ctcgcgcctg cccggagcgc tcatgcacac gctgccagcc gcccagatgg 481 tcatcacgga cctgtcggca cccgaggagc ggcccgcggc cctgggccgg ctgggcctct 541 gcttcggcgt cggagtcatc ctcggctccc tgctgggcgg gaccctggtc tccgcgtacg 601 ggattcagtg cccggccatc ctggctgccc tggccaccct cctgggagct gtcctcagct 661 tcacctgcat ccccgccagc accaaagggg ccaaaactga cgcccaggct ccactgccag 721 gcggcccccg ggccagtgtg ttcgacctga aggccatcgc ctccctgctg cggctgccag 781 acgtcccgag gatcttcctg gtgaaggtgg cctccaactg ccccacaggg ctcttcatgg 841 tcatgttctc catcatctcc atggacttct tccagctgga ggccgcccaa gctggctacc 901 tcatgtccTT CTTCGGGCTC CTCCAGATGG TGACCCAGGG CCTGGTCATC GGGCAGCTGA 961 GCAGCCACTT CTCGGAGGAG GTGCTGCTCC GGGCCAGCGT GCTGGTCTTC ATCGTGGTGG 1021 GCCTGGCCAT GGCCTGGATG TCCAGCGTCT TCCACTTCTG CCTCCTGGTG CCCGGCCTGG 1081 TGTTCAGCCT CTGCACCCTC AACGTGGTCA CCGACAGCAT GCTGATCAAG GCTGTCTCCA 1141 CCTCGGACAC AGGGACCATG CTGGGCCTCT GCGCCTCTGT ACAACCACTG CTCCGAACTC 1201 TGGGACCCAC GGTCGGCGGC CTCCTGTACC GCAGCTTTGG CGTCCCCGTC TTCGGCCACG 1261 TGCAGGTTGC TATCAATACC CTTGTCCTCC TGGTCCTCTG GAGGAAACCT ATGCCCCAGA 1321 GGAAGGACAA AGTCCGGTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1381 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1441 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATGACTGT TTCGAACAGC 1501 ACGCGGCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt