Transcript: Human NM_001315501.1

Homo sapiens solute carrier family 22 member 18 (SLC22A18), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
SLC22A18 (5002)
Length:
1776
CDS:
177..1706

Additional Resources:

NCBI RefSeq record:
NM_001315501.1
NBCI Gene record:
SLC22A18 (5002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001315501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344525 TGCCATACCTGTCTCGGAAAC pLKO_005 571 CDS 100% 6.000 8.400 N SLC22A18 n/a
2 TRCN0000353072 ACCGACAGCATGCTGATCAAG pLKO_005 1476 CDS 100% 4.950 6.930 N SLC22A18 n/a
3 TRCN0000038702 CTCGGTCATCTTGCTTACCTA pLKO.1 500 CDS 100% 3.000 4.200 N SLC22A18 n/a
4 TRCN0000038701 ACGTGCAGGTTGCTATCAATA pLKO.1 1624 CDS 100% 13.200 9.240 N SLC22A18 n/a
5 TRCN0000332984 ACGTGCAGGTTGCTATCAATA pLKO_005 1624 CDS 100% 13.200 9.240 N SLC22A18 n/a
6 TRCN0000038703 TGGCTACCTCATGTCCTTCTT pLKO.1 1259 CDS 100% 4.950 3.465 N SLC22A18 n/a
7 TRCN0000332983 TGGCTACCTCATGTCCTTCTT pLKO_005 1259 CDS 100% 4.950 3.465 N SLC22A18 n/a
8 TRCN0000369455 TTGCCTTCGGCTACCTGCAAA pLKO_005 607 CDS 100% 4.950 3.465 N SLC22A18 n/a
9 TRCN0000038699 CACAGAACTTACCTGCCTCTT pLKO.1 533 CDS 100% 4.050 2.835 N SLC22A18 n/a
10 TRCN0000369456 GTACAACCACTGCTCCGAACT pLKO_005 1545 CDS 100% 4.050 2.835 N SLC22A18 n/a
11 TRCN0000038700 CCCGAGGATCTTCCTGGTGAA pLKO.1 1151 CDS 100% 1.350 0.945 N SLC22A18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001315501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06675 pDONR223 100% 83.1% 83.1% None 1_255del;290G>A;489A>G n/a
2 ccsbBroad304_06675 pLX_304 0% 83.1% 83.1% V5 1_255del;290G>A;489A>G n/a
3 TRCN0000473253 TGACTGTTTCGAACAGCACGCGGC pLX_317 34% 83.1% 83.1% V5 1_255del;290G>A;489A>G n/a
Download CSV