Construct: ORF TRCN0000473391
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011778.1_s317c1
- Derived from:
- ccsbBroadEn_09824
- DNA Barcode:
- AAATCCACCTGTGTTCCCATTCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TCTE1 (202500)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473391
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 202500 | TCTE1 | t-complex-associated-testis... | NM_182539.4 | 99.6% | 99.6% | (many diffs) |
| 2 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_005248872.1 | 99.6% | 99.6% | (many diffs) |
| 3 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_011514336.3 | 99.6% | 99.6% | (many diffs) |
| 4 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_011514338.2 | 99.6% | 99.6% | (many diffs) |
| 5 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_005248873.2 | 82.3% | 82.2% | (many diffs) |
| 6 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_005248874.2 | 80% | 80.2% | (many diffs) |
| 7 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_006715009.3 | 80% | 80.2% | (many diffs) |
| 8 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_011514339.2 | 80% | 80.2% | (many diffs) |
| 9 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_011514340.1 | 69.7% | 69.6% | (many diffs) |
| 10 | human | 202500 | TCTE1 | t-complex-associated-testis... | XM_024446347.1 | 69.7% | 69.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1569
- ORF length:
- 1503
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggataccgta acgacatcag cattgttgga ccccagccac tcctcagtct 121 ccacccagga caattcctcc actggaggac acacttcaag cacaagccta cagctctcaa 181 agccttcaat cacaccagtc cctgcaaagt ccaggaaccc acgtcccagg gccaatatcc 241 gtcggatgcg ccggatcatt gctgaggatc ctgagtggtc actggccatc gtgcccctcc 301 tcacagagct ctgcattcag cacattatca ggaacttcca gaaaaaccct atcctgaagc 361 agatgctccc ggaacaccag cagaaggtcc tgaaccacct gtcccctgac ctaccactgg 421 ctgtgaccgc caacctgata gacagtgaga actactggct ccgctgctgc atgcatcgct 481 ggcccgtgtg ccacgtggcc caccatggcg gcagctggaa acgcatgttc ttcgagcggc 541 acctggagaa cctgctaaag cactttatcc caggcaccac agaccctgcg gtgatcctcg 601 acctgctgcc gctctgccgg aattacgtgc gcagggtcca cgtcgatcag ttccttccgc 661 cggtgcagct cccggcccag ctccggccgg gcgaccagtc cgactcaggc agcgagggag 721 agatggagga gcccaccgtt gaccactacc aactgggcga tctggtagct ggcctgagcc 781 acctggagga gctggacctg gtgtacgatg tcaaggactg cggcatgaat ttcgagtgga 841 atctcttcct cttcacctac cgcgactgcc tctccttggc agccgccatc aaggcatgcc 901 acaccctcaa gatcttcaag ctgacccgaa gcaaggtgga tgatgacaag gcacgcatca 961 taattcgaag ccttctggac cacccagtcc tcgaggagct ggacttgtca caaaacctca 1021 ttggagaccg tggtgcacga ggcgctgcca agctgctgag ccacagccgc ctgcgtgtgc 1081 tcaacctggc taacaaccag gtgcgtgcac ccggtgccca gtccctggct cacgctctgg 1141 cacacaacac caacctcatt tccctcaacc tacgtctcaa ctgcatcgag gatgagggtg 1201 gccaggctct tgcccatgcc ttgcagaCCA ACAAGTGCCT CACCACGCTG CACCTCGGTG 1261 GCAATGAGCT GTCTGAGCCC ACCGCCACAC TCCTGTCACA GGTGCTCGCC ATCAACACCA 1321 CACTCACCAG CATCAACCTG TCCTGCAACC ACATCGGGCT GGACGGTGGG AAGCAGCTCC 1381 TGGAAGGCAT GTCAGACAAC AAGACCCTCC TGGAATTTGA CTTGCGCCTG TCAGATGTGG 1441 CCCAGGAAAG CGAGTACCTC ATTGGCCAGG CCCTCTACGC AAACCGAGAA GCAGCCCGCC 1501 AGCGGGCCCT GAATCCCAGC CACTTCATGT CAACCATCAC TGCCAATGGC CCTGAGAACT 1561 CTGTGGGATA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1621 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1681 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAAAATCC ACCTGTGTTC CCATTCATAC 1741 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt