Transcript: Human NM_182539.4

Homo sapiens t-complex-associated-testis-expressed 1 (TCTE1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TCTE1 (202500)
Length:
3086
CDS:
134..1639

Additional Resources:

NCBI RefSeq record:
NM_182539.4
NBCI Gene record:
TCTE1 (202500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182539.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433546 AGGAAAGCGAGTACCTCATTG pLKO_005 1512 CDS 100% 10.800 15.120 N TCTE1 n/a
2 TRCN0000138425 CGGCATGAATTTCGAGTGGAA pLKO.1 889 CDS 100% 2.640 3.696 N TCTE1 n/a
3 TRCN0000137022 CTGCTAAAGCACTTTATCCCA pLKO.1 620 CDS 100% 0.750 0.600 N TCTE1 n/a
4 TRCN0000434186 CTCTGCATTCAGCACATTATC pLKO_005 377 CDS 100% 13.200 9.240 N TCTE1 n/a
5 TRCN0000136887 CCTGATAGACAGTGAGAACTA pLKO.1 502 CDS 100% 4.950 3.465 N TCTE1 n/a
6 TRCN0000168403 GAGAACCTGCTAAAGCACTTT pLKO.1 614 CDS 100% 4.950 3.465 N TCTE1 n/a
7 TRCN0000138810 GAATTTGACTTGCGCCTGTCA pLKO.1 1481 CDS 100% 2.640 1.848 N TCTE1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2025 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182539.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09824 pDONR223 100% 99.6% 99.6% None (many diffs) n/a
2 ccsbBroad304_09824 pLX_304 0% 99.6% 99.6% V5 (many diffs) n/a
3 TRCN0000473391 AAATCCACCTGTGTTCCCATTCAT pLX_317 23.1% 99.6% 99.6% V5 (many diffs) n/a
Download CSV