Construct: ORF TRCN0000473562
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012188.1_s317c1
- Derived from:
- ccsbBroadEn_09254
- DNA Barcode:
- GTACTCACTGGGCCCAACGCACGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAQR8 (85315)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473562
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 85315 | PAQR8 | progestin and adipoQ recept... | NM_133367.5 | 99.8% | 99.4% | 53A>G;598C>T |
| 2 | mouse | 74229 | Paqr8 | progestin and adipoQ recept... | NM_028829.3 | 86.4% | 93.5% | (many diffs) |
| 3 | mouse | 74229 | Paqr8 | progestin and adipoQ recept... | XM_006495577.2 | 86.4% | 93.5% | (many diffs) |
| 4 | mouse | 74229 | Paqr8 | progestin and adipoQ recept... | XM_006495578.3 | 86.4% | 93.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1128
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac gaccgccatc ttggagcgcc tgagcaccct gtcggtcagc gggcagcggc 121 tgcgccgcct gcccaagatc ctggaggatg ggcttcccaa gatgccttgc actgtcccag 181 aaacggatgt gccccagctc ttccgggagc cttacatccg caccggctac cgccccacgg 241 ggcacgagtg gcgctactac ttcttcagcc tctttcagaa acacaacgag gtggtcaacg 301 tctggaccca tttactggca gccctggccg tcctcttgcg attctgggcc tttgccgagg 361 ctgaggcctt gccatgggcg tctacccact ccctgcctct gctcctcttc atcctgtcgt 421 caatcactta cctcacctgc agccttctgg cccacctgct gcagtccaag tcagagctct 481 cccactacac cttctacttt gtggactatg ttggcgtgag cgtttaccaa tatggcagtg 541 ctttggctca tttcttctac agctctgacc aggcctggta tgaccggttc tggcttttct 601 tcttgccagc agctgccttc tgtggctggt tatcttgtgc tggctgttgc tatgccaaat 661 attgttaccg gaggccttat ccagtcatga ggaagatctg tcaagtggtg ccagcaggtc 721 tggcttttat cctagacatc agcccTGTGG CACACCGTGT GGCGCTCTGT CACCTGGCTG 781 GCTGCCAGGA GCAAGCAGCC TGGTACCACA CCCTCCAGAT CCTCTTCTTC CTGGTTAGCG 841 CTTATTTCTT CTCCTGCCCC GTGCCTGAGA AGTACTTCCC GGGTTCCTGT GACATCGTGG 901 GCCATGGGCA TCAGATCTTC CATGCATTTC TGTCCATCTG TACGCTCTCC CAGCTGGAGG 961 CCATCCTCCT GGACTACCAG GGGCGGCAGG AGATCTTCCT GCAGCGCCAT GGACCCCTAT 1021 CTGTCCACAT GGCCTGCCTC TCCTTCTTCT TCCTGGCTGC CTGCAGTGCT GCCACCGCAG 1081 CCCTTCTGAG GCACAAAGTC AAGGCCAGAC TGACCAAGAA AGATTCCTGC CCAACTTTCT 1141 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1201 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1261 GTGGAAAGGA CGAGTACTCA CTGGGCCCAA CGCACGGACG CGTTAAGTCg acaatcaacc 1321 tctggattac aaaatttgtg aaagatt