Transcript: Mouse XM_006495578.3

PREDICTED: Mus musculus progestin and adipoQ receptor family member VIII (Paqr8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Paqr8 (74229)
Length:
5306
CDS:
280..1344

Additional Resources:

NCBI RefSeq record:
XM_006495578.3
NBCI Gene record:
Paqr8 (74229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428428 GTCAAGGACAGACTGATTAAG pLKO_005 1312 CDS 100% 13.200 18.480 N Paqr8 n/a
2 TRCN0000125590 CGAGTGGCGTTACTACTTCTT pLKO.1 459 CDS 100% 4.950 6.930 N Paqr8 n/a
3 TRCN0000125591 GTCCCACTACACGTTCTACTT pLKO.1 693 CDS 100% 4.950 6.930 N Paqr8 n/a
4 TRCN0000125589 GCCAAGTATAACCTTGCCCTA pLKO.1 1906 3UTR 100% 2.160 1.728 N Paqr8 n/a
5 TRCN0000429306 CATTGGTAGAGAGTGCTTATA pLKO_005 1488 3UTR 100% 13.200 9.240 N Paqr8 n/a
6 TRCN0000414140 GATTCCTGAGGTCCTTCAAAT pLKO_005 1336 CDS 100% 13.200 9.240 N Paqr8 n/a
7 TRCN0000125592 TGGCTGTTGTTATGCCAAGTA pLKO.1 855 CDS 100% 4.950 3.465 N Paqr8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495578.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09254 pDONR223 100% 86.4% 93.5% None (many diffs) n/a
2 ccsbBroad304_09254 pLX_304 0% 86.4% 93.5% V5 (many diffs) n/a
3 TRCN0000473562 GTACTCACTGGGCCCAACGCACGG pLX_317 36.3% 86.4% 93.5% V5 (many diffs) n/a
4 TRCN0000487727 GCCGCTCAAACTCAGCGAACCATC pLX_317 25.2% 86.4% 93.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489902 AAAGTGCGTTAACTGTCTGCGACC pLX_317 33.9% 86.3% 93.2% V5 (many diffs) n/a
Download CSV