Construct: ORF TRCN0000473755
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015715.1_s317c1
- Derived from:
- ccsbBroadEn_12082
- DNA Barcode:
- AGGTTGGAGAAACGTCAGGCTAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DNAJB12 (54788)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473755
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54788 | DNAJB12 | DnaJ heat shock protein fam... | NM_001002762.4 | 100% | 100% | |
| 2 | human | 54788 | DNAJB12 | DnaJ heat shock protein fam... | NM_001365081.2 | 100% | 100% | |
| 3 | human | 54788 | DNAJB12 | DnaJ heat shock protein fam... | NM_017626.6 | 100% | 100% | |
| 4 | human | 54788 | DNAJB12 | DnaJ heat shock protein fam... | NM_001365080.2 | 98.4% | 98.1% | (many diffs) |
| 5 | human | 54788 | DNAJB12 | DnaJ heat shock protein fam... | NR_157570.2 | 35.8% | 1_22del;1148_3140del | |
| 6 | mouse | 56709 | Dnajb12 | DnaJ heat shock protein fam... | NM_019965.2 | 88.7% | 94.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1191
- ORF length:
- 1125
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga atccaacaag gatgaagctg agcgctgtat cagcatcgcc ctcaaggcca 121 tccagagcaa ccagcccgac cgggcgctcc gcttcctgga gaaggcacag cggctgtatc 181 cgacgccgcg agttcgcgcc ctgattgagt ccctcaacca gaaaccacag actgccggtg 241 accaaccccc acccacagac acaacccatg ccacccacag gaaagcaggt gggaccgatg 301 ccccctcggc caacggtgaa gctggaggag agagcaccaa aggctacact gcagaacagg 361 ttgcagctgt gaaaagggtc aagcaatgta aagattacta tgagatcctg ggggtgagca 421 gaggggcctc ggatgaggac ctgaagaagg cctaccgcag actggccctc aaattccacc 481 cagacaagaa ccacgcacct ggtgccactg aagccttcaa agccattggc acagcatatg 541 cggtactcag caacccggag aagaggaagc agtatgacca gttcggcgat gacaagagcc 601 aggcggcccg gcacggccat gggcatgggg atttccaccg tggctttgag gccgacatct 661 cccctgaaga cctcttcaac atgttctttg gcggcggctt cccTTCTAGT AACGTCCACG 721 TCTACAGCAA CGGCCGCATG CGCTATACCT ACCAGCAAAG GCAGGACCGC AGGGACAACC 781 AGGGTGATGG CGGGCTAGGG GTGTTTGTGC AGCTGATGCC TATCCTCATC CTGATTCTCG 841 TGTCAGCTCT CAGCCAGCTC ATGGTCTCCA GTCCACCCTA CAGTCTGAGT CCAAGACCGT 901 CCGTGGGCCA CATCCACAGG CGAGTCACTG ACCACCTGGG TGTCGTCTAC TATGTGGGAG 961 ACACTTTCTC CGAAGAGTAC ACAGGCTCCA GCCTCAAAAC AGTCGAGCGG AATGTGGAAG 1021 ATGATTATAT CGCCAACCTC CGGAACAACT GCTGGAAGGA GAAGCAGCAG AAGGAAGGCT 1081 TGCTGTACCG GGCACGCTAC TTTGGCGACA CAGATATGTA CCACAGAGCA CAGAAGATGG 1141 GCACCCCCAG CTGCAGCCGA CTGTCAGAGG TGCAGGCCTC CCTGCATGGA TACCCAACTT 1201 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1261 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1321 CTTGTGGAAA GGACGAAGGT TGGAGAAACG TCAGGCTAAT ACGCGTTAAG TCgacaatca 1381 acctctggat tacaaaattt gtgaaagatt