Transcript: Human NM_001002762.4

Homo sapiens DnaJ heat shock protein family (Hsp40) member B12 (DNAJB12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
DNAJB12 (54788)
Length:
4125
CDS:
23..1150

Additional Resources:

NCBI RefSeq record:
NM_001002762.4
NBCI Gene record:
DNAJB12 (54788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002762.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022296 TGCGCTATACCTACCAGCAAA pLKO.1 696 CDS 100% 4.950 6.930 N DNAJB12 n/a
2 TRCN0000022297 GCCTATCCTCATCCTGATTCT pLKO.1 775 CDS 100% 4.950 3.960 N DNAJB12 n/a
3 TRCN0000280269 GCCTATCCTCATCCTGATTCT pLKO_005 775 CDS 100% 4.950 3.960 N DNAJB12 n/a
4 TRCN0000022294 GCCAAGGTGATGGACTGTATA pLKO.1 2383 3UTR 100% 13.200 9.240 N DNAJB12 n/a
5 TRCN0000280331 GCCAAGGTGATGGACTGTATA pLKO_005 2383 3UTR 100% 13.200 9.240 N DNAJB12 n/a
6 TRCN0000022298 GCTGGAGGAGAGAGCACCAAA pLKO.1 278 CDS 100% 1.650 0.990 N DNAJB12 n/a
7 TRCN0000342911 GCTGGAGGAGAGAGCACCAAA pLKO_005 278 CDS 100% 1.650 0.990 N DNAJB12 n/a
8 TRCN0000009563 GTACCACAGAGCACAGAAGAT pLKO.1 1075 CDS 100% 0.000 0.000 N Dnajb12 n/a
9 TRCN0000280467 GTACCACAGAGCACAGAAGAT pLKO_005 1075 CDS 100% 0.000 0.000 N Dnajb12 n/a
10 TRCN0000022295 TCAAAGCCATTGGCACAGCAT pLKO.1 474 CDS 100% 2.640 1.320 Y DNAJB12 n/a
11 TRCN0000280268 TCAAAGCCATTGGCACAGCAT pLKO_005 474 CDS 100% 2.640 1.320 Y DNAJB12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002762.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12082 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12082 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473755 AGGTTGGAGAAACGTCAGGCTAAT pLX_317 43.4% 100% 100% V5 n/a
4 ccsbBroadEn_12081 pDONR223 100% 45.2% 45.3% None 1_615del;903C>T n/a
5 ccsbBroad304_12081 pLX_304 0% 45.2% 45.3% V5 1_615del;903C>T n/a
6 TRCN0000474022 AGCAATCCTAAAAAGCCGACTGCT pLX_317 70.3% 45.2% 45.3% V5 1_615del;903C>T n/a
Download CSV