Construct: ORF TRCN0000473768
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001505.1_s317c1
- Derived from:
- ccsbBroadEn_14086
- DNA Barcode:
- GACACGTTGAATGTCGAATGAGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SF3B3 (23450)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473768
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23450 | SF3B3 | splicing factor 3b subunit 3 | NM_012426.5 | 22% | 21.1% | (many diffs) |
| 2 | mouse | 101943 | Sf3b3 | splicing factor 3b, subunit 3 | NM_133953.2 | 20.2% | 21.1% | (many diffs) |
| 3 | mouse | 101943 | Sf3b3 | splicing factor 3b, subunit 3 | XM_006530518.3 | 20.2% | 21.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 891
- ORF length:
- 825
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt tctgtacaac tcaaccttgc agagagccac tggcatcagc tttgccattc 121 atggaaactt ttctggaacc aaacaacaag aaattgttgt ttcccgtggg aagatcttgg 181 agctgcttcg cccagacccc aacactggca aagtacatac cctactcact gtggaagtat 241 tcggtgttat ccggtcactc atggccttta ggctgacagg tggcaccaaa gactacattg 301 tagttggcag tgactctggt cgaattgtta ttttggaata ccagccatct aagaatatgt 361 ttgagaagat tcaccaagaa acctttggca agagtggatg ccgtcgcatc gttcctggcc 421 agttcttagc tgtggatccc aaagggcgag ccgttatgat tagtgccatt gagaaacaga 481 aattggtgta tattttgaac agagatgctg cagcccgact taccatttca tctcccctgg 541 aagcccacaa agcaaacact ttagtgtatc atgtagttgg agtagatgtc ggatttgaaa 601 atcCAATGTT TGCTTGTCTG GAAATGGATT ATGAGGAAGC AGACAATGAT CCAACAGGGG 661 AAGCAGCAGC TAATACCCAG CAGACACTTA CTTTCTATGA GCTAGACCTT GGTTTAAATC 721 ATGTGGTCCG AAAATACAGT GAACCTTTGG AGGAACACGG CAACTTCCTT ATTACAGTTC 781 CAGGAGGGTC AGATGGTCCA AGTGGAGTAC TGAACCTGAG TCCCCCATTC CCCAAAGCCA 841 TCCCTGCATT GATATGTCTT GACTCTCCTG TCTACTTTTG CACACACCCT TACCCAACTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGAGACA CGTTGAATGT CGAATGAGTT ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt