Transcript: Human NM_012426.5

Homo sapiens splicing factor 3b subunit 3 (SF3B3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SF3B3 (23450)
Length:
9692
CDS:
184..3837

Additional Resources:

NCBI RefSeq record:
NM_012426.5
NBCI Gene record:
SF3B3 (23450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012426.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315026 ACTATCGGACATAGGGTAATT pLKO_005 3166 CDS 100% 13.200 18.480 N SF3B3 n/a
2 TRCN0000000073 GTTGGAGTAGATGTCGGATTT pLKO.1 694 CDS 100% 10.800 15.120 N SF3B3 n/a
3 TRCN0000350453 GTTGGAGTAGATGTCGGATTT pLKO_005 694 CDS 100% 10.800 15.120 N SF3B3 n/a
4 TRCN0000000071 CACTGGAATTTGCATCGGGTT pLKO.1 2396 CDS 100% 2.160 1.728 N SF3B3 n/a
5 TRCN0000000069 AGGAGGGTGACTGGATAATTA pLKO.1 3925 3UTR 100% 15.000 10.500 N SF3B3 n/a
6 TRCN0000273331 AGGAGGGTGACTGGATAATTA pLKO_005 3925 3UTR 100% 15.000 10.500 N SF3B3 n/a
7 TRCN0000273274 TGAGAGTAACAACCTTATTAT pLKO_005 2559 CDS 100% 15.000 10.500 N SF3B3 n/a
8 TRCN0000273276 CTATCGGACATAGGGTAATTG pLKO_005 3167 CDS 100% 13.200 9.240 N SF3B3 n/a
9 TRCN0000000070 AGACAGATGAAGATATGGTTA pLKO.1 1130 CDS 100% 4.950 3.465 N SF3B3 n/a
10 TRCN0000273275 AGACAGATGAAGATATGGTTA pLKO_005 1130 CDS 100% 4.950 3.465 N SF3B3 n/a
11 TRCN0000000072 CCTAACACCAATGATGAAGTA pLKO.1 3361 CDS 100% 4.950 3.465 N SF3B3 n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 8891 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 8891 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000109222 GCAGACAAGTTTGGCAACATT pLKO.1 3322 CDS 100% 5.625 3.375 N Sf3b3 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 8889 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 8889 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 8889 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 7314 3UTR 100% 4.950 2.475 Y C16orf89 n/a
19 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 7347 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012426.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11736 pDONR223 100% 32.7% 32.7% None 1_2454del;2696C>T n/a
2 ccsbBroad304_11736 pLX_304 0% 32.7% 32.7% V5 1_2454del;2696C>T n/a
3 TRCN0000468692 TTGGAACTTTGTTTACTCGTGACA pLX_317 33.4% 32.7% 32.7% V5 1_2454del;2696C>T n/a
4 ccsbBroadEn_14086 pDONR223 100% 22% 21.1% None (many diffs) n/a
5 ccsbBroad304_14086 pLX_304 0% 22% 21.1% V5 (many diffs) n/a
6 TRCN0000473768 GACACGTTGAATGTCGAATGAGTT pLX_317 35.2% 22% 21.1% V5 (many diffs) n/a
Download CSV