Construct: ORF TRCN0000473776
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000121.1_s317c1
- Derived from:
- ccsbBroadEn_04012
- DNA Barcode:
- CCTTTAGAATGTTTTAAATAAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DUSP26 (78986)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473776
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 78986 | DUSP26 | dual specificity phosphatas... | NM_001305115.1 | 100% | 100% | |
| 2 | human | 78986 | DUSP26 | dual specificity phosphatas... | NM_001305116.1 | 100% | 100% | |
| 3 | human | 78986 | DUSP26 | dual specificity phosphatas... | NM_024025.3 | 100% | 100% | |
| 4 | mouse | 66959 | Dusp26 | dual specificity phosphatas... | NM_025869.3 | 90.6% | 96.6% | (many diffs) |
| 5 | mouse | 66959 | Dusp26 | dual specificity phosphatas... | XM_017312942.1 | 90.6% | 96.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 699
- ORF length:
- 633
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg ccctggtaac tggctttggg cttctatgac ttttatggcc cgcttctccc 121 ggagtagctc aaggtctcct gttcgaactc gagggaccct ggaggagatg ccaaccgttc 181 aacatccttt cctcaatgtc ttcgagttgg agcggctcct ctacacaggc aagacagcct 241 gtaaccatgc cgacgaggtc tggccaggcc tctatctcgg agaccaggac atggctaaca 301 accgccggga gcttcgccgc ctgggcatca cgcacgtcct caatgcctca cacagccggt 361 ggcgaggcac gcccgaggcc tatgaggggc tgggcatccg ctacctgggt gttgaggccc 421 acgactcgcc agcctttgac atgagcatcc acttccagac ggctgccgac ttcatccacc 481 gggcgctgag ccagccagga gggaagatCC TGGTGCATTG TGCTGTGGGC GTGAGCCGAT 541 CCGCCACCCT GGTACTGGCC TACCTCATGC TGTACCACCA CCTTACCCTC GTGGAGGCCA 601 TCAAGAAAGT CAAAGACCAC CGAGGCATCA TCCCCAACCG GGGCTTCCTG AGGCAGCTCC 661 TGGCCCTGGA CCGCAGGCTG CGGCAGGGTC TGGAAGCATG CCCAACTTTC TTGTACAAAG 721 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 781 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 841 ACGACCTTTA GAATGTTTTA AATAAAATAC GCGTTAAGTC gacaatcaac ctctggatta 901 caaaatttgt gaaagatt