Transcript: Mouse NM_025869.3

Mus musculus dual specificity phosphatase 26 (putative) (Dusp26), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dusp26 (66959)
Length:
1747
CDS:
453..1088

Additional Resources:

NCBI RefSeq record:
NM_025869.3
NBCI Gene record:
Dusp26 (66959)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081466 GCCTGTAACCATGCTGACGAA pLKO.1 624 CDS 100% 2.640 3.696 N Dusp26 n/a
2 TRCN0000081467 CGTGCTCAACGCCTCACACAA pLKO.1 722 CDS 100% 1.650 2.310 N Dusp26 n/a
3 TRCN0000081463 CCCAAGTGACAGGTAGTAGAA pLKO.1 1150 3UTR 100% 4.950 3.465 N Dusp26 n/a
4 TRCN0000081465 TCAACGTCTTTGAGTTGGAAA pLKO.1 580 CDS 100% 4.950 3.465 N Dusp26 n/a
5 TRCN0000355834 GCAAGACAGCCTGTAACCATG pLKO_005 616 CDS 100% 4.050 2.835 N DUSP26 n/a
6 TRCN0000081464 CCTCATGCTGTATCACCACTT pLKO.1 950 CDS 100% 4.050 2.430 N Dusp26 n/a
7 TRCN0000355899 GAGGGAAGATCCTGGTGCATT pLKO_005 886 CDS 100% 4.950 3.465 N DUSP26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025869.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04012 pDONR223 100% 90.6% 96.6% None (many diffs) n/a
2 ccsbBroad304_04012 pLX_304 0% 90.6% 96.6% V5 (many diffs) n/a
3 TRCN0000473776 CCTTTAGAATGTTTTAAATAAAAT pLX_317 30.7% 90.6% 96.6% V5 (many diffs) n/a
4 TRCN0000489384 TGCGGGGTTCGTTTACACCGACCA pLX_317 58.4% 90.6% 96.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV