Construct: ORF TRCN0000473788
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019024.3_s317c1
- Derived from:
- ccsbBroadEn_14557
- DNA Barcode:
- ATAGAGCGGACCTGACTTGCTACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDR1 (780)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473788
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001297652.1 | 99.9% | 100% | 2627_2628delTG |
| 2 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001297653.1 | 99.9% | 100% | 2627_2628delTG |
| 3 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001954.4 | 99.9% | 100% | 2627_2628delTG |
| 4 | human | 780 | DDR1 | discoidin domain receptor t... | XM_017011269.2 | 99.2% | 99.3% | 1883_1900del;2645_2646delTG |
| 5 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001202523.1 | 97.9% | 97.9% | 1_54del;2681_2682delTG |
| 6 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514888.3 | 97.2% | 97.3% | 1_54del;1937_1954del;2699_2700delTG |
| 7 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001297654.1 | 95.8% | 95.9% | 1513_1623del;2738_2739delTG |
| 8 | human | 780 | DDR1 | discoidin domain receptor t... | NM_013993.2 | 95.8% | 95.9% | 1513_1623del;2738_2739delTG |
| 9 | human | 780 | DDR1 | discoidin domain receptor t... | NM_013994.2 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 10 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514883.2 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 11 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514884.1 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 12 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514885.2 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 13 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514886.2 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 14 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514887.2 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 15 | human | 780 | DDR1 | discoidin domain receptor t... | XM_017011268.2 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 16 | human | 780 | DDR1 | discoidin domain receptor t... | XM_024446540.1 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 17 | human | 780 | DDR1 | discoidin domain receptor t... | XM_024446541.1 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 18 | human | 780 | DDR1 | discoidin domain receptor t... | XM_024446542.1 | 95.2% | 95.3% | 1513_1623del;1994_2011del;2756_2757delTG |
| 19 | human | 780 | DDR1 | discoidin domain receptor t... | XM_006715185.2 | 94% | 94% | 1_54del;1567_1677del;2792_2793delTG |
| 20 | human | 780 | DDR1 | discoidin domain receptor t... | XM_011514882.2 | 93.4% | 93.4% | (many diffs) |
| 21 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001202522.1 | 87.4% | 85.8% | 1345_1346ins82;1430_1431ins245;2300_2301delTG |
| 22 | human | 780 | DDR1 | discoidin domain receptor t... | NM_001202521.1 | 57.7% | 57.8% | 1514_1518delGTGCA;1521_1522insACA;1524_1525ins1104 |
| 23 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_172962.1 | 86.9% | 93.1% | (many diffs) |
| 24 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523538.3 | 86.9% | 93.1% | (many diffs) |
| 25 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_001198831.1 | 83.4% | 89.3% | (many diffs) |
| 26 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_001198833.1 | 83.4% | 89.3% | (many diffs) |
| 27 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | NM_007584.2 | 83.4% | 89.3% | (many diffs) |
| 28 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523533.1 | 83.4% | 89.3% | (many diffs) |
| 29 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523534.1 | 83.4% | 89.3% | (many diffs) |
| 30 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523535.3 | 83.4% | 89.3% | (many diffs) |
| 31 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523536.3 | 83.4% | 89.3% | (many diffs) |
| 32 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_006523537.1 | 83.4% | 89.3% | (many diffs) |
| 33 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XM_011246259.1 | 83.4% | 89.3% | (many diffs) |
| 34 | mouse | 12305 | Ddr1 | discoidin domain receptor f... | XR_001782030.1 | 59% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2697
- ORF length:
- 2628
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggaccagag gccctgtcat ctttactgct gctgctcttg gtggcaagtg 121 gagatgctga catgaaggga cattttgatc ctgccaagtg ccgctatgcc ctgggcatgc 181 aggaccggac catcccagac agtgacatct ctgcttccag ctcctggtca gattccactg 241 ccgcccgcca cagcaggttg gagagcagtg acggggatgg ggcctggtgc cccgcagggt 301 cggtgtttcc caaggaggag gagtacttgc aggtggatct acaacgactg cacctggtgg 361 ctctggtggg cacccaggga cggcatgccg ggggcctggg caaggagttc tcccggagct 421 accggctgcg ttactcccgg gatggtcgcc gctggatggg ctggaaggac cgctggggtc 481 aggaggtgat ctcaggcaat gaggaccctg agggagtggt gctgaaggac cttgggcccc 541 ccatggttgc ccgactggtt cgcttctacc cccgggctga ccgggtcatg agcgtctgtc 601 tgcgggtaga gctctatggc tgcctctgga gggatggact cctgtcttac accgcccctg 661 tggggcagac aatgtattta tctgaggccg tgtacctcaa cgactccacc tatgacggac 721 ataccgtggg cggactgcag tatgggggtc tgggccagct ggcagatggt gtggtggggc 781 tggatgactt taggaagagt caggagctgc gggtctggcc aggctatgac tatgtgggat 841 ggagcaacca cagcttctcc agtggctatg tggagatgga gtttgagttt gaccggctga 901 gggccttcca ggctatgcag gtccactgta acaacatgca cacgctggga gcccgtctgc 961 ctggcggggt ggaatgtcgc ttccggcgtg gccctgccat ggcctgggag ggggagccca 1021 tgcgccacaa cctagggggc aacctggggg accccagagc ccgggctgtc tcagtgcccc 1081 ttggcggccg tgtggctcgc tttctgcagt gccgcttcct ctttgcgggg ccctggttac 1141 tcttcagcga aatctccttc atctctgatg tggtgaacaa ttcctctccg gcactgggag 1201 gcaccttccc gccagccccc tggtggccgc ctggcccacc tcccaccaac ttcagcagct 1261 tggagctgga gcccagaggc cagcagcccg tggccaaggc cgaggggagc ccgaccgcca 1321 tcctcatcgg ctgcctggtg gccatcatcc tgctcctgct gctcatcatt gccctcatgc 1381 tctggcggct gcactggcgc aggctcctca gcaaggctga acggagggtg ttggaagagg 1441 agctgacggt tcacctctct gtccctgggg acactatcct catcaacaac cgcccaggtc 1501 ctagagagcc acccccgtac caggagcccc ggcctcgtgg gaatccgccc cactccgctc 1561 cctgtgtccc caatggctct gcctacagtg gggactatat ggagcctgag aagccaggcg 1621 ccccgcttct gcccccacct ccccagaaca gcgtccccca ttatgccgag gctgacattg 1681 ttaccctgca gggcgtcacc gggggcaaca cctatgctgt gcctgcactg cccccagggg 1741 cagtcgggga tgggcccccc agagtggatt tccctcgatc tcgactccgc ttcaaggaga 1801 agcttggcga gggccagttt ggggaggtgc acctgtgtga ggtcgacagc cctcaagatc 1861 tggttagtct tgatttcccc cttaatgtgc gtaagggaca ccctttgctg gtagctgtca 1921 agatcttacg gccagatgcc accaagaatg ccaggaatga tttcctgaaa gaggtgaaga 1981 tcatgtcgag gctcaaggac ccaaacatca ttcggctgct gggcgtgtgt gtgcaggacg 2041 accccctctg catgattact gactacatgg agaacggcga cctcaaccag ttcctcagtg 2101 cccaccagct ggaggacaag gcagccgagg gggcccctgg ggacgggcag gctgcgcagg 2161 ggcccaccat cagctaccca atgctgctgc atgtggcagc ccagatcgcc tccggcatgc 2221 gctatctggC CACACTCAAC TTTGTACATC GGGACCTGGC CACGCGGAAC TGCCTAGTTG 2281 GGGAAAATTT CACCATCAAA ATCGCAGACT TTGGCATGAG CCGGAACCTC TATGCTGGGG 2341 ACTATTACCG TGTGCAGGGC CGGGCAGTGC TGCCCATCCG CTGGATGGCC TGGGAGTGCA 2401 TCCTCATGGG GAAGTTCACG ACTGCGAGTG ACGTGTGGGC CTTTGGTGTG ACCCTGTGGG 2461 AGGTGCTGAT GCTCTGTAGG GCCCAGCCCT TTGGGCAGCT CACCGACGAG CAGGTCATCG 2521 AGAACGCGGG GGAGTTCTTC CGGGACCAGG GCCGGCAGGT GTACCTGTCC CGGCCGCCTG 2581 CCTGCCCGCA GGGCCTATAT GAGCTGATGC TTCGGTGCTG GAGCCGGGAG TCTGAGCAGC 2641 GACCACCCTT TTCCCAGCTG CATCGGTTCC TGGCAGAGGA TGCACTCAAC ACGGTGCCAA 2701 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 2761 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 2821 TATCTTGTGG AAAGGACGAA TAGAGCGGAC CTGACTTGCT ACGACGCGTT AAGTCgacaa 2881 tcaacctctg gattacaaaa tttgtgaaag att