Construct: ORF TRCN0000473803
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002146.1_s317c1
- Derived from:
- ccsbBroadEn_15359
- DNA Barcode:
- CGCTCATCGTTCTCACACACCAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGAP5 (394)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473803
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 394 | ARHGAP5 | Rho GTPase activating prote... | NM_001173.3 | 15.1% | 14.5% | (many diffs) |
2 | human | 394 | ARHGAP5 | Rho GTPase activating prote... | XM_017021288.1 | 15.1% | 14.5% | (many diffs) |
3 | human | 394 | ARHGAP5 | Rho GTPase activating prote... | NM_001030055.2 | 15.1% | 14.5% | (many diffs) |
4 | human | 394 | ARHGAP5 | Rho GTPase activating prote... | XM_005267635.4 | 15.1% | 14.5% | (many diffs) |
5 | human | 394 | ARHGAP5 | Rho GTPase activating prote... | XM_005267636.4 | 15.1% | 14.5% | (many diffs) |
6 | mouse | 11855 | Arhgap5 | Rho GTPase activating prote... | XM_006515439.2 | 13.8% | 14% | (many diffs) |
7 | mouse | 11855 | Arhgap5 | Rho GTPase activating prote... | NM_009706.2 | 13.8% | 14% | (many diffs) |
8 | mouse | 11855 | Arhgap5 | Rho GTPase activating prote... | XM_006515438.3 | 13.8% | 14% | (many diffs) |
9 | mouse | 11855 | Arhgap5 | Rho GTPase activating prote... | XM_011243989.1 | 13.8% | 14% | (many diffs) |
10 | mouse | 11855 | Arhgap5 | Rho GTPase activating prote... | XM_011243990.1 | 13.8% | 14% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gctgccgccg ccaccgccgg ggccgctgcc gttgaggagg agacggagga 121 gaccgacgtt gttagggtta tgtaccgaag gactctaccg tgtcagcggg aataaaactg 181 accaagacaa tattcaaaag cagtttgatc aagatcataa tatcaatcta gtgtcaatgg 241 aagtaacagt aaatgctgta gctggagccc ttaaagcttt ctttgcagat ctgccagatc 301 ctttaattcc atattctctt catccagaac tattggaagc agcaaaaatc ccggataaaa 361 cagaacgtct tcatgccttg aaagaaattg ttaagaaatt tcatcctgta aactatgatg 421 tattcagata cgtgataaca catctaaaca gggttagtca gcaacataaa atcaaccTAA 481 TGACAGCAGA CAACTTATCC ATCTGTTTTT GGCCAACCTT GATGAGACCT GATTTTGAAA 541 ATCGAGAGTT TCTGTCTACT ACTAAGATTC ATCAATCTGT TGTTGAAACA TTCATTCAGC 601 AGTGTCAGTT TTTCTTTTAC AATGGAGAAA TTGTAGAAAC GACAAACATT GTGGCTCCTC 661 CACCACCTTC AAACCCAGGA CAGTTGGTGG AACCAATGGT GCCACTTCAG TTGCCGCCAC 721 CATTGCAACC TCAGCTGATA CAACCACAAT TACAAACGGA TCCTCTTGGT ATTATATGCC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GACGCTCATC GTTCTCACAC ACCAGCACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt