Transcript: Human XM_005267635.4

PREDICTED: Homo sapiens Rho GTPase activating protein 5 (ARHGAP5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP5 (394)
Length:
7977
CDS:
285..4793

Additional Resources:

NCBI RefSeq record:
XM_005267635.4
NBCI Gene record:
ARHGAP5 (394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005267635.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321111 TGGTACATATCCTCGTAAATT pLKO_005 2486 CDS 100% 15.000 21.000 N Arhgap5 n/a
2 TRCN0000364531 TGGTACATATCCTCGTAAATT pLKO_005 2486 CDS 100% 15.000 21.000 N ARHGAP5 n/a
3 TRCN0000369094 GCGGAACCCATTGATACAATT pLKO_005 3558 CDS 100% 13.200 18.480 N ARHGAP5 n/a
4 TRCN0000369040 GTGCTAATTTGGGCAACTTAA pLKO_005 5200 3UTR 100% 13.200 18.480 N ARHGAP5 n/a
5 TRCN0000006479 CCCTATAATAACTACCCTGAT pLKO.1 3204 CDS 100% 4.050 5.670 N ARHGAP5 n/a
6 TRCN0000006475 TGATTGCAAACAGGCTGGATT pLKO.1 4802 3UTR 100% 4.950 3.960 N ARHGAP5 n/a
7 TRCN0000364431 GCAATTTCTGTCACCTTATAT pLKO_005 5076 3UTR 100% 15.000 10.500 N ARHGAP5 n/a
8 TRCN0000364433 TACGAATTTGCAACCATATAT pLKO_005 611 CDS 100% 15.000 10.500 N ARHGAP5 n/a
9 TRCN0000321112 AGCATGACTGGAGAGGTTTAA pLKO_005 4975 3UTR 100% 13.200 9.240 N Arhgap5 n/a
10 TRCN0000364430 ATCACGATAGTACCAATATAG pLKO_005 2044 CDS 100% 13.200 9.240 N ARHGAP5 n/a
11 TRCN0000369093 TGATGAATGCGTGGATCATTA pLKO_005 887 CDS 100% 13.200 9.240 N ARHGAP5 n/a
12 TRCN0000360350 ATTGCAATCAGTATATCATTC pLKO_005 5050 3UTR 100% 10.800 7.560 N Arhgap5 n/a
13 TRCN0000006476 CCCATCAAAGTGAAGATGTTT pLKO.1 3157 CDS 100% 5.625 3.938 N ARHGAP5 n/a
14 TRCN0000012703 GCACGATTTAATGTCAACATT pLKO.1 969 CDS 100% 5.625 3.938 N Arhgap5 n/a
15 TRCN0000006477 CCCATCCTATACCATCAGTAT pLKO.1 314 CDS 100% 4.950 3.465 N ARHGAP5 n/a
16 TRCN0000364491 TACCGTGTCAGCGGGAATAAA pLKO_005 4170 CDS 100% 0.000 0.000 N ARHGAP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005267635.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13814 pDONR223 100% 99.9% 12.7% None (many diffs) n/a
2 ccsbBroad304_13814 pLX_304 0% 99.9% 12.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473979 ACGATACGAGTCGATGAAGAGCAC pLX_317 9% 99.9% 12.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15359 pDONR223 0% 15.1% 14.5% None (many diffs) n/a
5 ccsbBroad304_15359 pLX_304 0% 15.1% 14.5% V5 (many diffs) n/a
6 TRCN0000473803 CGCTCATCGTTCTCACACACCAGC pLX_317 42.4% 15.1% 14.5% V5 (many diffs) n/a
Download CSV