Construct: ORF TRCN0000473877
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010328.1_s317c1
- Derived from:
- ccsbBroadEn_14143
- DNA Barcode:
- AGTGAGACGCCTCCTTGAGTGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NUSAP1 (51203)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473877
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001301136.2 | 99.8% | 99.7% | 15T>A;1320T>A |
| 2 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_016359.5 | 99.6% | 99.5% | 15T>A;304_306delCAG;1323T>A |
| 3 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001243142.2 | 99.6% | 99.5% | 15T>A;655_656insAGC;1317T>A |
| 4 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_018454.8 | 99.3% | 99.3% | (many diffs) |
| 5 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720560.4 | 98.5% | 98.4% | 15T>A;445_462del;1338T>A |
| 6 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720559.3 | 98.2% | 98.2% | (many diffs) |
| 7 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_005254428.3 | 98% | 97.9% | (many diffs) |
| 8 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001243143.2 | 96.6% | 96.5% | 15T>A;303_304ins42;1278T>A |
| 9 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_005254430.5 | 96.4% | 96.3% | (many diffs) |
| 10 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720561.3 | 95.3% | 95.2% | (many diffs) |
| 11 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720563.3 | 90.5% | 90.4% | (many diffs) |
| 12 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720562.3 | 89.5% | 89.4% | (many diffs) |
| 13 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_005254431.3 | 89.3% | 89.2% | (many diffs) |
| 14 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_017022294.2 | 87.5% | 87.5% | (many diffs) |
| 15 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001243144.2 | 85.3% | 85.2% | (many diffs) |
| 16 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_017022295.1 | 55.8% | 55.6% | 0_1ins582;738T>A |
| 17 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XR_001751299.2 | 51.7% | (many diffs) | |
| 18 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XR_001751300.2 | 50.1% | (many diffs) | |
| 19 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XR_001751301.2 | 45.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1386
- ORF length:
- 1320
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat catcccctca ctagaggagc tggactccct caagtacagt gacctgcaga 121 acttagccaa gagtctgggt ctccgggcca acctgagggc aaccaagttg ttaaaagcct 181 tgaaaggcta cattaaacat gaggcaagaa aaggaaatga gaatcaggat gaaagtcaaa 241 cttctgcatc ctcttgtgat gagactgaga tacagatcag caaccaggaa gaagctgaga 301 gacagccact tggccatgtc accaaaacaa ggagaaggtg caagactgtc cgtgtggacc 361 ctgactcaca gaatcattca gagataaaaa taagtaatcc cactgaattc cagaatcatg 421 aaaagcagga aagccaggat ctcagagcta ctgcaaaagt tccttctcca ccagacgagc 481 accaagaagc tgagaatgct gtttcctcag gtaacagaga ttcaaaggta ccttcagaag 541 gaaagaaatc tctctacaca gatgagtcat ccaaacctgg aaaaaataaa agaactgcaa 601 tcactactcc aaactttaag aagcttcatg aagctcattt taaggaaatg gagtccattg 661 atcaatatat tgagagaaaa aagaaacatt ttgaagaaca caattccatg aatgaactga 721 agcagcagcc catcaataag ggaggggtca ggactccagt acctccaaga ggaagactct 781 ctgtggcttc tactcccatc agccaacgac gctcgcaagg ccggtcttgt ggccctgcaa 841 gtcagagtac cttgggtctg aaggggtcac tcaagcgcTC TGCTATCTCT GCAGCTAAAA 901 CGGGTGTCAG GTTTTCAGCT GCTACTAAAG ATAATGAGCA TAAGCGTTCA CTGACCAAGA 961 CTCCAGCCAG AAAGTCTGCA CATGTGACCG TGTCTGGGGG CACCCCAAAA GGCGAGGCTG 1021 TGCTTGGGAC ACACAAATTA AAGACCATCA CGGGGAATTC TGCTGCTGTT ATTACCCCAT 1081 TCAAGTTGAC AACTGAGGCA ACGCAGACTC CAGTCTCCAA TAAGAAACCA GTGTTTGATC 1141 TTAAAGCAAG TTTGTCTCGT CCCCTCAACT ATGAACCACA CAAAGGAAAG CTAAAACCAT 1201 GGGGGCAATC TAAAGAAAAT AATTATCTAA ATCAACATGT CAACAGAATT AACTTCTACA 1261 AGAAAACTTA CAAACAACCC CATCTCCAGA CAAAGGAAGA GCAACGGAAG AAACGCGAGC 1321 AAGAACGAAA GGAGAAGAAA GCAAAGGTTT TGGGAATGCG AAGGGGCCTC ATTTTGGCTG 1381 AAGAATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1441 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1501 CTTGGCTTTA TATATCTTGT GGAAAGGACG AAGTGAGACG CCTCCTTGAG TGTTTACGCG 1561 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt