Transcript: Human XM_006720563.3

PREDICTED: Homo sapiens nucleolar and spindle associated protein 1 (NUSAP1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUSAP1 (51203)
Length:
2157
CDS:
88..1293

Additional Resources:

NCBI RefSeq record:
XM_006720563.3
NBCI Gene record:
NUSAP1 (51203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137707 GCATAAGCGTTCACTGACCAA pLKO.1 960 CDS 100% 2.640 3.696 N NUSAP1 n/a
2 TRCN0000297990 GCATAAGCGTTCACTGACCAA pLKO_005 960 CDS 100% 2.640 3.696 N NUSAP1 n/a
3 TRCN0000135712 GAGGGCAACCAAGTTGTTAAA pLKO.1 177 CDS 100% 13.200 9.240 N NUSAP1 n/a
4 TRCN0000136422 CCTCAGGTAACAGAGATTCAA pLKO.1 530 CDS 100% 5.625 3.938 N NUSAP1 n/a
5 TRCN0000292376 CCTCAGGTAACAGAGATTCAA pLKO_005 530 CDS 100% 5.625 3.938 N NUSAP1 n/a
6 TRCN0000138033 GAACTGAAGCAGCCCATCAAT pLKO.1 739 CDS 100% 5.625 3.938 N NUSAP1 n/a
7 TRCN0000138049 CAGATCAGCAACCAGGAAGAA pLKO.1 295 CDS 100% 4.950 3.465 N NUSAP1 n/a
8 TRCN0000138922 GAGCACCAAGAAGCTGAGAAT pLKO.1 502 CDS 100% 4.950 2.970 N NUSAP1 n/a
9 TRCN0000292377 GAGCACCAAGAAGCTGAGAAT pLKO_005 502 CDS 100% 4.950 2.970 N NUSAP1 n/a
10 TRCN0000135357 GACTGAGATACAGATCAGCAA pLKO.1 285 CDS 100% 2.640 1.584 N NUSAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15831 pDONR223 0% 91.1% 91.1% None 1002_1003ins117 n/a
2 ccsbBroad304_15831 pLX_304 0% 91.1% 91.1% V5 1002_1003ins117 n/a
3 ccsbBroadEn_11964 pDONR223 100% 90.9% 90.9% None 304_306delCAG;1002_1003ins117 n/a
4 ccsbBroad304_11964 pLX_304 0% 90.9% 90.9% V5 (not translated due to prior stop codon) 304_306delCAG;1002_1003ins117 n/a
5 TRCN0000481132 CATTTGACACAATCTCGTGGTCCC pLX_317 36.8% 90.9% 90.9% V5 (not translated due to prior stop codon) 304_306delCAG;1002_1003ins117 n/a
6 ccsbBroadEn_14143 pDONR223 100% 90.5% 90.4% None (many diffs) n/a
7 ccsbBroad304_14143 pLX_304 0% 90.5% 90.4% V5 (many diffs) n/a
8 TRCN0000473877 AGTGAGACGCCTCCTTGAGTGTTT pLX_317 38.6% 90.5% 90.4% V5 (many diffs) n/a
9 ccsbBroadEn_11963 pDONR223 100% 42.2% 42.2% None 1_645del;1002_1003ins117 n/a
10 ccsbBroad304_11963 pLX_304 0% 42.2% 42.2% V5 1_645del;1002_1003ins117 n/a
11 TRCN0000472748 ATTCAGGCAAATGCCAGCTAATAA pLX_317 74.5% 42.2% 42.2% V5 1_645del;1002_1003ins117 n/a
Download CSV