Construct: ORF TRCN0000473882
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002749.1_s317c1
- Derived from:
- ccsbBroadEn_02183
- DNA Barcode:
- TCGACTCCTTCTCTTGTCGCTGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCAMP1 (9522)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473882
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9522 | SCAMP1 | secretory carrier membrane ... | NM_004866.6 | 100% | 100% | |
| 2 | human | 9522 | SCAMP1 | secretory carrier membrane ... | NM_001290229.2 | 92.3% | 92.3% | 57_58ins78 |
| 3 | human | 9522 | SCAMP1 | secretory carrier membrane ... | XM_011543727.3 | 89.9% | 89.6% | 631_632ins102 |
| 4 | human | 9522 | SCAMP1 | secretory carrier membrane ... | NR_110885.2 | 13.9% | 1_55del;527_528ins160;910_5983del | |
| 5 | mouse | 107767 | Scamp1 | secretory carrier membrane ... | NM_029153.1 | 86.4% | 98.2% | (many diffs) |
| 6 | mouse | 107767 | Scamp1 | secretory carrier membrane ... | NM_001346609.1 | 73.2% | 83.1% | (many diffs) |
| 7 | mouse | 107767 | Scamp1 | secretory carrier membrane ... | XM_006517515.2 | 73.2% | 83.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1080
- ORF length:
- 1014
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggatttcgac agtaacccgt ttgccgaccc ggatctcaac aatcccttca 121 aggatccatc agttacacaa gtgacaagaa atgttccacc aggacttgat gaatataatc 181 cattctcgga ttctagaaca cctccaccag gcggtgtgaa gatgcctaat gtacccaata 241 cacaaccagc aataatgaaa ccaacagagg aacatccagc ttatacacag attgcaaagg 301 aacatgcatt ggcccaagct gaacttctta agcgccagga agaactagaa agaaaagccg 361 cagaattaga tcgtcgggaa cgagaaatgc aaaacctcag tcaacatggt agaaaaaata 421 attggccacc tcttcctagc aattttcctg tcggaccttg tttctatcag gatttttctg 481 tagacattcc tgtagaattc caaaagacag taaagcttat gtactacttg tggatgttcc 541 atgcagtaac actgtttcta aatatcttcg gatgcttggc ttggttttgt gttGATTCTG 601 CAAGAGCGGT TGATTTTGGA TTGAGTATCC TGTGGTTCTT GCTTTTTACT CCTTGTTCAT 661 TTGTCTGTTG GTACAGACCA CTTTATGGAG CTTTCAGGAG TGACAGTTCA TTTAGATTCT 721 TTGTATTCTT CTTCGTCTAT ATTTGTCAGT TTGCTGTACA TGTACTCCAA GCTGCAGGAT 781 TTCATAACTG GGGCAATTGT GGTTGGATTT CATCCCTTAC TGGTCTCAAC CAAAATATTC 841 CTGTTGGAAT CATGATGATA ATCATAGCAG CACTTTTCAC AGCATCAGCA GTCATCTCAC 901 TAGTTATGTT CAAAAAAGTA CATGGACTAT ATCGCACAAC AGGTGCTAGT TTTGAGAAGG 961 CCCAACAGGA GTTTGCAACA GGTGTGATGT CCAACAAAAC TGTCCAGACC GCAGCTGCAA 1021 ATGCAGCTTC AACTGCAGCA TCTAGTGCAG CTCAGAATGC TTTCAAGGGT AACCAGATTT 1081 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1141 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1201 TTTATATATC TTGTGGAAAG GACGATCGAC TCCTTCTCTT GTCGCTGGAA CGCGTTAAGT 1261 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt