Transcript: Mouse NM_029153.1

Mus musculus secretory carrier membrane protein 1 (Scamp1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Scamp1 (107767)
Length:
3605
CDS:
6..1022

Additional Resources:

NCBI RefSeq record:
NM_029153.1
NBCI Gene record:
Scamp1 (107767)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105420 GCTCTGTAGTAGATAATGTAT pLKO.1 1530 3UTR 100% 5.625 7.875 N Scamp1 n/a
2 TRCN0000105424 AGTCGGGATCATGATGATAAT pLKO.1 782 CDS 100% 13.200 10.560 N Scamp1 n/a
3 TRCN0000105423 CGGGATCATGATGATAATCAT pLKO.1 785 CDS 100% 0.563 0.450 N Scamp1 n/a
4 TRCN0000105422 CTGTTGACATTCCTGTAGAAT pLKO.1 418 CDS 100% 5.625 3.938 N Scamp1 n/a
5 TRCN0000105421 GCTTATGTACTACCTATGGAT pLKO.1 455 CDS 100% 3.000 2.100 N Scamp1 n/a
6 TRCN0000154334 CAGAGGAACATCCAGCTTATA pLKO.1 205 CDS 100% 13.200 9.240 N SCAMP1 n/a
7 TRCN0000343182 CAGAGGAACATCCAGCTTATA pLKO_005 205 CDS 100% 13.200 9.240 N SCAMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02183 pDONR223 100% 86.4% 98.2% None (many diffs) n/a
2 ccsbBroad304_02183 pLX_304 0% 86.4% 98.2% V5 (many diffs) n/a
3 TRCN0000473882 TCGACTCCTTCTCTTGTCGCTGGA pLX_317 48% 86.4% 98.2% V5 (many diffs) n/a
4 ccsbBroadEn_11381 pDONR223 100% 40.5% 45.8% None (many diffs) n/a
5 ccsbBroad304_11381 pLX_304 0% 40.5% 45.8% V5 (many diffs) n/a
6 TRCN0000473716 ACCTCAACCCCCCAACTTCCCTGC pLX_317 82% 40.5% 45.8% V5 (many diffs) n/a
Download CSV