Construct: ORF TRCN0000474100
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018832.2_s317c1
- Derived from:
- ccsbBroadEn_15225
- DNA Barcode:
- GATTTCACCTATACAATAAAACCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- SLAMF6 (114836)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474100
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 114836 | SLAMF6 | SLAM family member 6 | NM_052931.5 | 99.5% | 22.4% | 216_217insC;230_231insG;271_272delTCinsNN |
| 2 | human | 114836 | SLAMF6 | SLAM family member 6 | NM_001184714.2 | 99.2% | 22.3% | (many diffs) |
| 3 | human | 114836 | SLAMF6 | SLAM family member 6 | XM_017000215.2 | 95% | 22.1% | (many diffs) |
| 4 | human | 114836 | SLAMF6 | SLAM family member 6 | NM_001184715.2 | 84.8% | 7.7% | (many diffs) |
| 5 | human | 114836 | SLAMF6 | SLAM family member 6 | XM_017000216.1 | 84.5% | 7.7% | (many diffs) |
| 6 | human | 114836 | SLAMF6 | SLAM family member 6 | XM_017000217.1 | 66.3% | 15.1% | 49_50ins335 |
| 7 | human | 114836 | SLAMF6 | SLAM family member 6 | NM_001184716.2 | 66.1% | 15% | 49_50ins335;463_465delGCA |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 327
- ORF length:
- 258
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttgtggctg ttccaatcgc tcctgtttgt cttctgcttt ggcccaggga 121 atgtagtttc acaaagcagc ttaaccccat tgatggtgaa cgggattctg ggggagtcag 181 taactcttcc cctggagttt cctgcaggag agaaggtcaa cttcatcact tggcttttca 241 atgaaacatc tcttgccttc atagtacccc atgaaaccaa aagtcccaga aatccacgtg 301 gactaatccg aaacagggaa agcgactgaa cttcacccag nnctactccc tgcaactcag 361 caacctgaag atggaagaca caggctctta cagagcccag atatccacaa agacctctgc 421 aaagctgtcc agttacactc tgaggatatt aagacaactg aggaacatac aagttaccaa 481 tcacagtcag ctatttcaga atatgacctg tgagctccat ctgacttgct ctgtggagga 541 tgcagatgac aatgtctcat tcagatggga ggccttggga aacacacttt caagtcagcc 601 aaacctcact gtctcctggg accccaggat ttccagtgaa caggactaca ccTGCATAGC 661 AGAGAATGCT GTCAGTAATT TATCCTTCTC TGTCTCTGCC CAGAAGCTTT GCGAAGATGT 721 TAAAATTCAA TATACAGATA CCAAAATGAT TCTGTTTATG GTTTCTGGGA TATGCATAGT 781 CTTCGGTTTC ATCATACTGC TGTTACTTGT TTTGAGGAAA AGAAGAGATT CCCTATCTTT 841 GTCTACTCAG CGAACACAGG GCCCCGAGTC CGCAAGGAAC CTAGAGTATG TTTCAGTGTC 901 TCCAACGAAC AACACTGTGT ATGCTTCAGT CACTCATTCA AACAGGGAAA CAGAAATCTG 961 GACACCTAGA GAAAATGATA CTATCACAAT TTACTCCACA ATTAATCATT CCAAAGAGAG 1021 TAAACCCACT TTTTCCAGGG CAACTGCCCT TGACAATGTC GTGTTGCCAA CTTTCTTGTA 1081 CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA 1141 GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG 1201 AAAGGACGAG ATTTCACCTA TACAATAAAA CCAACGCGTT AAGTCgacaa tcaacctctg 1261 gattacaaaa tttgtgaaag att