Construct: ORF TRCN0000474131
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017163.1_s317c1
- Derived from:
- ccsbBroadEn_09331
- DNA Barcode:
- GACAACGGATGCTCATCTCATCGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- DAPL1 (92196)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474131
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 92196 | DAPL1 | death associated protein li... | NM_001017920.3 | 99% | 16C>T;179T>C;243G>A |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 84
- ORF length:
- 15
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcaaatgaa gtgtaagacc tgctctcccc tcggaaaggg ggacatcctc 121 ctgcagtaaa agctggagga atgagaattt ccaaaaaaca agaaattggc accttggaaa 181 gacataccaa aaaaacagga ttcgagaaaa caagtgccat tgcaaatgtt gccaaaatac 241 agacaccgga tgccctGAAT GACGCACTGG AGAAGCTCAA CTATAAATTT CCAGCAACAG 301 TGCACATGGC ACATCAAAAA CCCACACCTG CTCTGGAAAA GGTTGTTCCA CTGAAAAGGA 361 TCTACATTAT TCAGCAGCCT CGAAAATGTT TGCCAACTTT CTTGTACAAA GTGGTTGATA 421 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 481 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGACAA 541 CGGATGCTCA TCTCATCGCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 601 tgaaagatt