Transcript: Human NM_001017920.3

Homo sapiens death associated protein like 1 (DAPL1), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
DAPL1 (92196)
Length:
549
CDS:
57..380

Additional Resources:

NCBI RefSeq record:
NM_001017920.3
NBCI Gene record:
DAPL1 (92196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017920.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107220 CGTCTGGCCAGCTGCCTCGAA pLKO.1 401 3UTR 100% 0.000 0.000 N DAPL1 n/a
2 TRCN0000107222 CACTGGAGAAGCTCAACTATA pLKO.1 253 CDS 100% 13.200 9.240 N DAPL1 n/a
3 TRCN0000107221 GCCATTGCAAATGTTGCCAAA pLKO.1 204 CDS 100% 4.050 2.835 N DAPL1 n/a
4 TRCN0000107223 CAAGAAATTGGCACCTTGGAA pLKO.1 147 CDS 100% 3.000 2.100 N DAPL1 n/a
5 TRCN0000107224 ACATTATTCAGCAGCCTCGAA pLKO.1 352 CDS 100% 2.640 1.848 N DAPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017920.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09331 pDONR223 100% 99% None 16C>T;179T>C;243G>A n/a
2 ccsbBroad304_09331 pLX_304 0% 99% V5 (not translated due to prior stop codon) 16C>T;179T>C;243G>A n/a
3 TRCN0000474131 GACAACGGATGCTCATCTCATCGC pLX_317 41.8% 99% V5 (not translated due to prior stop codon) 16C>T;179T>C;243G>A n/a
Download CSV