Construct: ORF TRCN0000474193
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018790.2_s317c1
- Derived from:
- ccsbBroadEn_14595
- DNA Barcode:
- TGTTATCCATAAATTTTCACTACC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- CRKL (1399)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474193
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1399 | CRKL | CRK like proto-oncogene, ad... | NM_005207.4 | 99.6% | 22.8% | 155_156insG;174_175insT;248C>N |
| 2 | human | 1399 | CRKL | CRK like proto-oncogene, ad... | NR_156180.2 | 26.6% | (many diffs) | |
| 3 | mouse | 12929 | Crkl | v-crk avian sarcoma virus C... | NM_007764.5 | 90.2% | 22.5% | (many diffs) |
| 4 | mouse | 12929 | Crkl | v-crk avian sarcoma virus C... | NM_001277231.1 | 30.7% | 32.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 519
- ORF length:
- 450
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtcctccgcc aggttcgact cctcggaccg ctccgcctgg tatatggggc 121 cggtgtctcg ccaggaggcg cagacccggc tccagggcca gcgccacggt atgttcctcg 181 tccgcgattc ttccacctgc cctggggact atgtgctgtc ggtggtccga gaactcgcgg 241 gtcttcccac tacatcatca actcgctgcc caaccgccgt tttaagatcg gggaccagga 301 atttgaccat ttgccggncc tgctggagtt ttacaagatc cactacctgg acaccaccac 361 cctcatcgag cctgcgccca ggtatccaag cccaccaatg ggatctgtct cagcacccaa 421 cctgcctaca gcagaagata acctggaata tgtacggact ctgtatgatt ttcctgggaa 481 tgatgccgaa gacctgccct ttaaaaaggg tgagatccta gtgataatag agaagccTGA 541 AGAACAGTGG TGGAGTGCCC GGAACAAGGA TGGCCGGGTT GGGATGATTC CTGTCCCTTA 601 TGTCGAAAAG CTTGTGAGAT CCTCACCACA CGGAAAGCAT GGAAATAGGA ATTCCAACAG 661 TTATGGGATC CCAGAACCTG CTCATGCATA CGCTCAACCT CAGACCACAA CTCCTCTACC 721 TGCAGTTTCC GGTTCTCCTG GGGCAGCAAT CACCCCTTTG CCATCCACAC AGAATGGACC 781 TGTCTTTGCG AAAGCAATCC AGAAAAGAGT ACCCTGTGCT TATGACAAGA CTGCCTTGGC 841 ATTAGAGGTT GGTGACATCG TGAAAGTCAC AAGGATGAAT ATAAATGGCC AGTGGGAAGG 901 CGAAGTGAAC GGGCGCAAAG GGCTTTTCCC CTTTACGCAC GTCAAAATCT TTGACCCTCA 961 AAACCCAGAT GAAAACGAGT TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC 1021 TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA 1081 AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATGTTA TCCATAAATT 1141 TTCACTACCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg tgaaagatt