Construct: ORF TRCN0000474240
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016716.1_s317c1
- Derived from:
- ccsbBroadEn_14008
- DNA Barcode:
- GGACACTACTCCGTAAAGGTACGT
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPZL1 (9019)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474240
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9019 | MPZL1 | myelin protein zero like 1 | NM_003953.6 | 99.8% | 98.1% | 794delA |
| 2 | human | 9019 | MPZL1 | myelin protein zero like 1 | NM_024569.5 | 77.7% | 75.5% | 604_605ins103;627_628ins76 |
| 3 | human | 9019 | MPZL1 | myelin protein zero like 1 | NM_001146191.2 | 44.1% | 42.3% | 257_258ins450;344delA |
| 4 | mouse | 68481 | Mpzl1 | myelin protein zero-like 1 | NM_001083897.1 | 84.2% | 81.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 873
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agcgtccgcc ggagccgggg cggtgattgc agccccagac agccggcgct 121 ggctgtggtc ggtgctggcg gcggcgcttg ggctcttgac agctggagta tcagccttgg 181 aagtatatac gccaaaagaa atcttcgtgg caaatggtac acaagggaag ctgacctgca 241 agttcaagtc tactagtacg actggcgggt tgacctcagt ctcctggagc ttccagccag 301 agggggccga cactactgtg tcgtttttcc actactccca agggcaagtg taccttggga 361 attatccacc atttaaagac agaatcagct gggctggaga ccttgacaag aaagatgcat 421 caatcaacat agaaaatatg cagtttatac acaatggcac ctatatctgt gatgtcaaaa 481 accctcctga catcgttgtc cagcctggac acattaggct ctatgtcgta gaaaaagaga 541 atttgcctgt gtttccagtt tGGGTAGTGG TGGGCATAGT TACTGCTGTG GTCCTAGGTC 601 TCACTCTGCT CATCAGCATG ATTCTGGCTG TCCTCTATAG AAGGAAAAAC TCTAAACGGG 661 ATTACACTGG CTGCAGTACA TCAGAGAGTT TGTCACCAGT TAAGCAGGCT CCTCGGAAGT 721 CCCCCTCCGA CACTGAGGGT CTTGTAAAGA GTCTGCCTTC TGGATCTCAC CAGGGCCCAG 781 TCATATATGC ACAGTTAGAC CACTCCGGCG GACATCACAG TGACAAGATT AACAAGTCAG 841 AGTCTGTGGT GTATGCGGTA TCCGAAAGAA TTACCCAACT TTCTTGTACA AAGTGGTTGA 901 TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG 961 TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGAGGA 1021 CACTACTCCG TAAAGGTACG TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt 1081 tgtgaaagat t